ID: 1060657232

View in Genome Browser
Species Human (GRCh38)
Location 9:125380482-125380504
Sequence TGGGGGACCCAGAGACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060657232_1060657244 26 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657244 9:125380531-125380553 TCCTTCCATCTGTTGGGGGTGGG No data
1060657232_1060657239 19 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657239 9:125380524-125380546 GATCAGGTCCTTCCATCTGTTGG No data
1060657232_1060657241 21 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657241 9:125380526-125380548 TCAGGTCCTTCCATCTGTTGGGG No data
1060657232_1060657243 25 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657243 9:125380530-125380552 GTCCTTCCATCTGTTGGGGGTGG No data
1060657232_1060657242 22 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657242 9:125380527-125380549 CAGGTCCTTCCATCTGTTGGGGG No data
1060657232_1060657246 27 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657246 9:125380532-125380554 CCTTCCATCTGTTGGGGGTGGGG No data
1060657232_1060657240 20 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657240 9:125380525-125380547 ATCAGGTCCTTCCATCTGTTGGG No data
1060657232_1060657238 3 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657238 9:125380508-125380530 GTGCTTGTCTGCTGCAGATCAGG No data
1060657232_1060657247 30 Left 1060657232 9:125380482-125380504 CCAGGATGTCTCTGGGTCCCCCA No data
Right 1060657247 9:125380535-125380557 TCCATCTGTTGGGGGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060657232 Original CRISPR TGGGGGACCCAGAGACATCC TGG (reversed) Intergenic
No off target data available for this crispr