ID: 1060660295

View in Genome Browser
Species Human (GRCh38)
Location 9:125401473-125401495
Sequence AAGCCCATACTGCTAATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060660295_1060660303 30 Left 1060660295 9:125401473-125401495 CCAGTCATTAGCAGTATGGGCTT No data
Right 1060660303 9:125401526-125401548 CTTTGTTAGCTGGGCAACACTGG No data
1060660295_1060660298 -10 Left 1060660295 9:125401473-125401495 CCAGTCATTAGCAGTATGGGCTT No data
Right 1060660298 9:125401486-125401508 GTATGGGCTTGGGAGCCATCTGG No data
1060660295_1060660302 21 Left 1060660295 9:125401473-125401495 CCAGTCATTAGCAGTATGGGCTT No data
Right 1060660302 9:125401517-125401539 AGTGACTCACTTTGTTAGCTGGG No data
1060660295_1060660301 20 Left 1060660295 9:125401473-125401495 CCAGTCATTAGCAGTATGGGCTT No data
Right 1060660301 9:125401516-125401538 TAGTGACTCACTTTGTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060660295 Original CRISPR AAGCCCATACTGCTAATGAC TGG (reversed) Intergenic
No off target data available for this crispr