ID: 1060664729

View in Genome Browser
Species Human (GRCh38)
Location 9:125426020-125426042
Sequence GTGTCAAGACTGTAAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060664729_1060664733 22 Left 1060664729 9:125426020-125426042 CCTCCCATTTACAGTCTTGACAC No data
Right 1060664733 9:125426065-125426087 GTTTTGAAGCCAGTTGCAGCAGG No data
1060664729_1060664734 23 Left 1060664729 9:125426020-125426042 CCTCCCATTTACAGTCTTGACAC No data
Right 1060664734 9:125426066-125426088 TTTTGAAGCCAGTTGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060664729 Original CRISPR GTGTCAAGACTGTAAATGGG AGG (reversed) Intergenic
No off target data available for this crispr