ID: 1060666010

View in Genome Browser
Species Human (GRCh38)
Location 9:125432687-125432709
Sequence GCTACTATGTGGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060666004_1060666010 -10 Left 1060666004 9:125432674-125432696 CCTCCTGCCTGGGGCTACTATGT No data
Right 1060666010 9:125432687-125432709 GCTACTATGTGGAGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060666010 Original CRISPR GCTACTATGTGGAGGCAGGA AGG Intergenic
No off target data available for this crispr