ID: 1060671767

View in Genome Browser
Species Human (GRCh38)
Location 9:125476057-125476079
Sequence GAATTCCTATGGAGTAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060671767_1060671774 2 Left 1060671767 9:125476057-125476079 CCTGGGTTACTCCATAGGAATTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1060671774 9:125476082-125476104 AAAAGGGTGGCTCTGGGAGCAGG No data
1060671767_1060671776 12 Left 1060671767 9:125476057-125476079 CCTGGGTTACTCCATAGGAATTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1060671776 9:125476092-125476114 CTCTGGGAGCAGGGAGCCAGAGG No data
1060671767_1060671777 20 Left 1060671767 9:125476057-125476079 CCTGGGTTACTCCATAGGAATTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1060671777 9:125476100-125476122 GCAGGGAGCCAGAGGAAGCTAGG No data
1060671767_1060671772 -5 Left 1060671767 9:125476057-125476079 CCTGGGTTACTCCATAGGAATTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1060671772 9:125476075-125476097 AATTCTCAAAAGGGTGGCTCTGG No data
1060671767_1060671773 -4 Left 1060671767 9:125476057-125476079 CCTGGGTTACTCCATAGGAATTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1060671773 9:125476076-125476098 ATTCTCAAAAGGGTGGCTCTGGG No data
1060671767_1060671775 3 Left 1060671767 9:125476057-125476079 CCTGGGTTACTCCATAGGAATTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1060671775 9:125476083-125476105 AAAGGGTGGCTCTGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060671767 Original CRISPR GAATTCCTATGGAGTAACCC AGG (reversed) Intronic
900612067 1:3548466-3548488 GAATTCCTAGAGAGTTACACAGG + Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
915514160 1:156402962-156402984 GGATGTCTACGGAGTAACCCGGG + Intergenic
918698015 1:187568497-187568519 GAATTGCTTTGGGTTAACCCTGG + Intergenic
921837588 1:219794118-219794140 CATTGCCTATGGATTAACCCAGG + Intronic
922068326 1:222166210-222166232 GACTTCGTATGAATTAACCCTGG - Intergenic
1063294658 10:4792591-4792613 GAATTCCTAGGGAGGAACTGGGG - Intronic
1063361268 10:5461197-5461219 GATTTCCTTTGGAGTATCTCAGG + Intergenic
1070790385 10:79185808-79185830 GAATCCCCCTGGAATAACCCTGG + Intronic
1072863524 10:99032425-99032447 GGATTCCACTGAAGTAACCCAGG + Intronic
1075900517 10:126039403-126039425 GAATTCCTATGGTTAAACCTTGG + Exonic
1078571340 11:12460651-12460673 GAATTCCTAAGAGGTAACCTTGG - Intronic
1079238227 11:18704606-18704628 GACTTCCTATGCAGGAAACCAGG + Exonic
1080454865 11:32408948-32408970 GAATTCCTAGGGAATACTCCTGG - Intronic
1081724780 11:45320669-45320691 GTATTCCCATGCAGTATCCCTGG - Intergenic
1082625409 11:55478484-55478506 GAATTACTATGAAGAAACTCTGG + Intergenic
1085871582 11:80356664-80356686 GAAAGCCTTTGGAGTAATCCAGG - Intergenic
1087989032 11:104724479-104724501 GAAGCCCTATGGAGAAACCCAGG + Intergenic
1090401949 11:126454606-126454628 GAACTTGTATGGAGAAACCCAGG + Intronic
1095427733 12:42095209-42095231 CAATCCCTATGGAGGAACACAGG + Intronic
1098614905 12:72509957-72509979 GAATTCATATGGAATTACCTTGG - Intronic
1099967203 12:89461258-89461280 GACTTCCTATGGAGGAAACACGG + Intronic
1101063611 12:100996920-100996942 ATATACCTATGGTGTAACCCTGG - Intronic
1117715049 14:58571935-58571957 AAATTCCTAGGGAGAATCCCAGG + Intergenic
1121487852 14:94332179-94332201 GAATTCCTCAGGATCAACCCTGG - Intergenic
1134464512 16:14462968-14462990 GAATTCCTGTGCAGATACCCAGG - Intronic
1136062406 16:27735671-27735693 GAGTTCCTGTGGCGTAACGCAGG + Intronic
1139448499 16:67013422-67013444 GGATTCCTATGGAGGATCCTAGG - Intergenic
1151122059 17:71803548-71803570 GAATTTATATGGTGTAACCAAGG - Intergenic
1156044894 18:32867052-32867074 GAATGCTTTTGGAGCAACCCTGG + Intergenic
1167807096 19:51795274-51795296 GGATTCCTGTGGAGCAACTCAGG - Exonic
928335942 2:30398242-30398264 GAATTCCTCTAGAGTCATCCTGG - Intergenic
941279945 2:163537414-163537436 CAATTCATATGCAGTAACTCAGG + Intergenic
942252385 2:174058508-174058530 GAAATCCTCTGGAGAAAGCCAGG + Intergenic
946255226 2:218437107-218437129 GAAGACCTATTGAGAAACCCAGG - Exonic
1169185890 20:3616815-3616837 GAATTCTTGTGTAGAAACCCAGG + Intronic
1173674332 20:44820854-44820876 GAATTCATATGGAATCACGCGGG + Intergenic
1176009883 20:62887565-62887587 AAATGCCTGTGGAGTAACCTCGG - Intronic
949862971 3:8523290-8523312 GAATGCCCAAGGAGCAACCCTGG + Intronic
950654695 3:14429238-14429260 CACTTGCTATGGAGTAACCTTGG + Intronic
951546353 3:23829912-23829934 GAATTTCTGTAGAGAAACCCTGG + Intronic
954279672 3:49567928-49567950 GAAATCATATGGAGAAGCCCTGG - Intronic
967151200 3:186652478-186652500 GAATCCCCAGGGAGAAACCCTGG + Exonic
970919101 4:21371835-21371857 GAATTCATCTAGACTAACCCTGG + Intronic
973564697 4:52172406-52172428 GGAGTCCTGTGGAGTGACCCAGG + Intergenic
977449220 4:97173768-97173790 GAATTTCTCTGGTGTAACCCTGG + Intergenic
980298889 4:130962298-130962320 GAATTGCTATCGAGGAACTCTGG + Intergenic
988948549 5:36233366-36233388 CAATTCCTATGGAGAAAGACAGG + Intronic
991301601 5:65134011-65134033 GAATTCCTACAGAGTTACACAGG + Intergenic
998532034 5:142894267-142894289 GCATTTCTATGAAGTATCCCTGG + Exonic
1000728886 5:164805975-164805997 CACTGCCTATGGGGTAACCCTGG - Intergenic
1005441629 6:25875424-25875446 GAATTCAGAAGGAGGAACCCGGG + Intronic
1006234158 6:32613666-32613688 GTATTCCCATGGAGTTACCAAGG - Intergenic
1006306975 6:33228610-33228632 GAATTCCTATGCGGCAACGCTGG - Intergenic
1007887867 6:45252873-45252895 GCATTCCTATGGATTATTCCTGG + Intronic
1011389147 6:86832658-86832680 GAATTCCTATGAAGTATGCAGGG - Intergenic
1012243315 6:96898090-96898112 GAACTCCGAGGGAGTCACCCGGG + Intergenic
1012986706 6:105883749-105883771 GAATTCCAGTGGGGTAACCAGGG - Intergenic
1018283066 6:162208258-162208280 TAACTCCTGTGGAGTAACCAAGG + Intronic
1020143626 7:5626147-5626169 GAATTCTTATGTGTTAACCCTGG - Intronic
1030664672 7:112262940-112262962 GGATTACGATGGAGAAACCCTGG - Intronic
1035824141 8:2626776-2626798 AAATTCCTAGGCAGTAACACAGG + Intergenic
1050921708 9:11211770-11211792 TAATTCTTATGGTGTAATCCTGG - Intergenic
1055152036 9:73012204-73012226 GAATTCCTATGGAGTTAAGAAGG + Intronic
1055734818 9:79315344-79315366 GTATTCCCATGGACTAAGCCTGG - Intergenic
1056313553 9:85367253-85367275 GAAATCCTATCGAGTTACTCTGG + Intergenic
1056477450 9:86966872-86966894 GATTTCCTATGTATTGACCCAGG + Intergenic
1060671767 9:125476057-125476079 GAATTCCTATGGAGTAACCCAGG - Intronic
1060880903 9:127117368-127117390 GAATTCCTATTTAGTAACCTAGG - Intronic
1187247628 X:17567299-17567321 GAATTCCTCTGCAGTCACTCTGG + Intronic