ID: 1060672200

View in Genome Browser
Species Human (GRCh38)
Location 9:125479700-125479722
Sequence CCATCAGAAGACAAGCAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060672189_1060672200 22 Left 1060672189 9:125479655-125479677 CCCCTGACTTTCTCAGAAACAAC 0: 1
1: 0
2: 1
3: 30
4: 255
Right 1060672200 9:125479700-125479722 CCATCAGAAGACAAGCAACTGGG No data
1060672190_1060672200 21 Left 1060672190 9:125479656-125479678 CCCTGACTTTCTCAGAAACAACT 0: 1
1: 0
2: 1
3: 36
4: 433
Right 1060672200 9:125479700-125479722 CCATCAGAAGACAAGCAACTGGG No data
1060672191_1060672200 20 Left 1060672191 9:125479657-125479679 CCTGACTTTCTCAGAAACAACTG 0: 1
1: 0
2: 0
3: 22
4: 353
Right 1060672200 9:125479700-125479722 CCATCAGAAGACAAGCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060672200 Original CRISPR CCATCAGAAGACAAGCAACT GGG Intronic
No off target data available for this crispr