ID: 1060674322

View in Genome Browser
Species Human (GRCh38)
Location 9:125498817-125498839
Sequence AAAGGGAAGGAGAGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3132
Summary {0: 1, 1: 4, 2: 27, 3: 344, 4: 2756}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060674322_1060674337 22 Left 1060674322 9:125498817-125498839 CCCTCCCCACTCTCCTTCCCTTT 0: 1
1: 4
2: 27
3: 344
4: 2756
Right 1060674337 9:125498862-125498884 AGCCAACATACATCTCCTCGAGG No data
1060674322_1060674338 23 Left 1060674322 9:125498817-125498839 CCCTCCCCACTCTCCTTCCCTTT 0: 1
1: 4
2: 27
3: 344
4: 2756
Right 1060674338 9:125498863-125498885 GCCAACATACATCTCCTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060674322 Original CRISPR AAAGGGAAGGAGAGTGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr