ID: 1060674322 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:125498817-125498839 |
| Sequence | AAAGGGAAGGAGAGTGGGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3132 | |||
| Summary | {0: 1, 1: 4, 2: 27, 3: 344, 4: 2756} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060674322_1060674337 | 22 | Left | 1060674322 | 9:125498817-125498839 | CCCTCCCCACTCTCCTTCCCTTT | 0: 1 1: 4 2: 27 3: 344 4: 2756 |
||
| Right | 1060674337 | 9:125498862-125498884 | AGCCAACATACATCTCCTCGAGG | No data | ||||
| 1060674322_1060674338 | 23 | Left | 1060674322 | 9:125498817-125498839 | CCCTCCCCACTCTCCTTCCCTTT | 0: 1 1: 4 2: 27 3: 344 4: 2756 |
||
| Right | 1060674338 | 9:125498863-125498885 | GCCAACATACATCTCCTCGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060674322 | Original CRISPR | AAAGGGAAGGAGAGTGGGGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||