ID: 1060677090

View in Genome Browser
Species Human (GRCh38)
Location 9:125525049-125525071
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060677083_1060677090 29 Left 1060677083 9:125524997-125525019 CCCAAATGAGCAGCTGCGCAGAC 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1060677090 9:125525049-125525071 ACATGGACTCAATTTGAGCTGGG No data
1060677084_1060677090 28 Left 1060677084 9:125524998-125525020 CCAAATGAGCAGCTGCGCAGACA 0: 1
1: 0
2: 4
3: 4
4: 196
Right 1060677090 9:125525049-125525071 ACATGGACTCAATTTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr