ID: 1060678569

View in Genome Browser
Species Human (GRCh38)
Location 9:125540193-125540215
Sequence GTGAAAAATCAGAAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1020
Summary {0: 1, 1: 0, 2: 3, 3: 74, 4: 942}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060678569_1060678573 -9 Left 1060678569 9:125540193-125540215 CCTACCACCTTCTGATTTTTCAC 0: 1
1: 0
2: 3
3: 74
4: 942
Right 1060678573 9:125540207-125540229 ATTTTTCACAAATGAAAACTGGG No data
1060678569_1060678574 -8 Left 1060678569 9:125540193-125540215 CCTACCACCTTCTGATTTTTCAC 0: 1
1: 0
2: 3
3: 74
4: 942
Right 1060678574 9:125540208-125540230 TTTTTCACAAATGAAAACTGGGG No data
1060678569_1060678576 12 Left 1060678569 9:125540193-125540215 CCTACCACCTTCTGATTTTTCAC 0: 1
1: 0
2: 3
3: 74
4: 942
Right 1060678576 9:125540228-125540250 GGGAAGGAGTGCCAGACTGAAGG No data
1060678569_1060678572 -10 Left 1060678569 9:125540193-125540215 CCTACCACCTTCTGATTTTTCAC 0: 1
1: 0
2: 3
3: 74
4: 942
Right 1060678572 9:125540206-125540228 GATTTTTCACAAATGAAAACTGG No data
1060678569_1060678575 -4 Left 1060678569 9:125540193-125540215 CCTACCACCTTCTGATTTTTCAC 0: 1
1: 0
2: 3
3: 74
4: 942
Right 1060678575 9:125540212-125540234 TCACAAATGAAAACTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060678569 Original CRISPR GTGAAAAATCAGAAGGTGGT AGG (reversed) Intronic
900733130 1:4276078-4276100 GTGAAATTGCAGAAGGAGGTGGG + Intergenic
900734431 1:4287406-4287428 GTCAAAGATCAGATGGTTGTAGG + Intergenic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
903023035 1:20407343-20407365 GTCAAAGATCAGATGGTTGTAGG - Intergenic
905420986 1:37843881-37843903 GTGCAAGATCAGATGGGGGTTGG - Intronic
905953101 1:41969409-41969431 GTCAAAGATCAGATGGTTGTAGG - Intronic
906381967 1:45338412-45338434 TTGAAAAATGATAAGGTGTTAGG - Intronic
906878984 1:49568855-49568877 GTGGAAGATCAGATGGTTGTAGG - Intronic
906979666 1:50616144-50616166 GTCAAAAATCAGATGGTTGTAGG + Intronic
907141249 1:52187166-52187188 GTCAAAGATCAGATGGTTGTAGG - Intronic
907860757 1:58350747-58350769 GTCAAAGATCAGATGGTTGTAGG + Intronic
908198993 1:61774534-61774556 GTGAAGAATCTAATGGTGGTAGG - Intronic
908864780 1:68535062-68535084 GTTGAAAATCAGATGGTTGTAGG - Intergenic
909163061 1:72179293-72179315 GTTGAAAATCAGATGGTTGTAGG + Intronic
909260858 1:73487589-73487611 GTCAAAGATCAGATGGTTGTAGG + Intergenic
909273929 1:73660489-73660511 GTCAAAAATCAGATGGTTGTAGG - Intergenic
909345788 1:74584689-74584711 GTGAAAAATAAGCATGTGATGGG - Intronic
909374894 1:74928767-74928789 GTCAAAGATCAGATGGTTGTAGG - Intergenic
909695222 1:78460776-78460798 GTCAAAGATCAGATGGTTGTAGG + Intronic
909806640 1:79880990-79881012 GTCAAAGATCAGATGGTTGTAGG - Intergenic
909856885 1:80545849-80545871 ATGAAAACTAAGAAGGTGATTGG + Intergenic
910016420 1:82530411-82530433 GTCAAAGATCAGATGGTTGTAGG + Intergenic
910082484 1:83357501-83357523 GAGGAAAATCAGATGGTTGTAGG + Intergenic
910260336 1:85288133-85288155 TTAAAAAATGAGAAGGTGGCTGG + Intergenic
910813229 1:91259257-91259279 GTCAAAGATCAGATGGTTGTAGG - Intergenic
910996124 1:93106058-93106080 GGAAAAAATGAGGAGGTGGTGGG + Intronic
911082028 1:93942839-93942861 TTGAAAAACCAAAAGGTGGCCGG + Intergenic
911117574 1:94262103-94262125 GTCAAAGATCAGATGGTTGTAGG - Intronic
911272515 1:95820281-95820303 GTCAAAGATCAGATGGTTGTAGG + Intergenic
911701011 1:100951729-100951751 GGGAGAAATCAGGAGGTTGTTGG - Intronic
911785110 1:101936808-101936830 GTCAAAGATCAGATGGTTGTAGG - Intronic
911874389 1:103140552-103140574 GTCAAAGATCAGATGGTTGTAGG - Intergenic
911971989 1:104451045-104451067 GTCAAAAATCAGTAGGTGTGTGG + Intergenic
912803709 1:112739133-112739155 GTGGAAGATCAGATGGTCGTAGG - Intergenic
912957050 1:114162197-114162219 GTCAAAGATCAGATGGTTGTAGG - Intergenic
913391132 1:118313671-118313693 GTCAAAGATCAGATGGTTGTAGG - Intergenic
914405561 1:147368282-147368304 GTCAAAGATCAGATGGTTGTAGG + Intergenic
915771354 1:158428305-158428327 GTTAAAGATCAGATGGTTGTAGG + Intergenic
916061787 1:161103814-161103836 CTGAAAAATCAGAGTGTGGGGGG + Intronic
916646223 1:166787945-166787967 GTCAAAGATCAGATGGTTGTAGG + Intergenic
916904521 1:169267620-169267642 GTCAAAGATCAGATGGTTGTAGG - Intronic
917006914 1:170425688-170425710 GTCAAAGATCAGACGGTTGTAGG - Intergenic
917181247 1:172300513-172300535 GTCAAAGATCAGATGGTTGTAGG - Intronic
917248122 1:173026675-173026697 GTCAAAAATCAGATGGTTGTGGG + Intergenic
917267599 1:173238108-173238130 GTCAAAGATCAGATGGTTGTAGG - Intergenic
917290336 1:173465990-173466012 GTCAAAGATCAGATGGTTGTAGG - Intergenic
917352120 1:174089199-174089221 GTCAAAGATCAGATGGTTGTAGG + Intergenic
917363529 1:174203397-174203419 GTCAAAGATCAGATGGTTGTAGG + Intronic
917809040 1:178639858-178639880 GTTAAAAATCAAATGGTTGTTGG - Intergenic
917832616 1:178909192-178909214 GTCAAAGATCAGATGGTAGTAGG + Intronic
918100776 1:181371875-181371897 GTGGAAAATCAGATGGTTGTAGG + Intergenic
918249837 1:182692829-182692851 TTCAAAGATCAGAAGGTTGTGGG - Intergenic
918665187 1:187142256-187142278 GTCAAAGATCAGATGGTTGTAGG - Intergenic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
918842404 1:189558706-189558728 GTCAAATATCAGATGGTTGTAGG - Intergenic
918858850 1:189795210-189795232 GTCAAAGATCAGATGGTGGTAGG + Intergenic
919009313 1:191939274-191939296 GTCAAAGATCAGATGGTGGTAGG + Intergenic
919195318 1:194277495-194277517 GTCAAATATCAGATGGTTGTAGG - Intergenic
919203716 1:194392989-194393011 GTCAAAGATCAGATGGTTGTAGG - Intergenic
919235139 1:194831235-194831257 GTCAAAGATCAGATGGTTGTAGG - Intergenic
919239907 1:194901000-194901022 GTCAAAGATCAGATGGTTGTAGG - Intergenic
919287524 1:195583109-195583131 GTCAAAGATCAGATGGTTGTAGG - Intergenic
919355850 1:196520648-196520670 GTCAAAGATCAGATGGTTGTAGG - Intronic
919594301 1:199542876-199542898 GTGAAAGATCAGATGGCGGTAGG - Intergenic
919833500 1:201558119-201558141 GTGAAGTTTCAGAGGGTGGTGGG - Intergenic
920540728 1:206776042-206776064 CTGGGAAATCAGAAGGTTGTGGG + Intergenic
920927467 1:210356246-210356268 CTGCAAAATCAGAAGGTTCTAGG - Intronic
921104709 1:211964672-211964694 GTCAAAGATCAGATGGTTGTAGG - Intronic
921390742 1:214610971-214610993 GTCAAAGATCAGATGGTTGTAGG + Intronic
921540574 1:216409582-216409604 CTCAAAGATCAGATGGTGGTAGG - Intronic
922254319 1:223879257-223879279 GAGAGAAATCAGATGGTGGCTGG - Intergenic
922386807 1:225094328-225094350 GTCAAAGATCAGATGGTCGTAGG - Intronic
922681464 1:227601061-227601083 GTCAAAGATCAGATGGTTGTGGG + Intronic
922843203 1:228661529-228661551 GTCAAAGATCAGATGGTTGTAGG - Intergenic
922858952 1:228799026-228799048 ATGAAAAATCTCAAGGTGGCTGG + Intergenic
923002475 1:230018864-230018886 GTCAAAGATCAGATGGTTGTAGG + Intergenic
923179721 1:231504583-231504605 GTCAAAGATCAGACGGTTGTAGG + Intergenic
923930238 1:238686096-238686118 GTCAAAGATCAGATGGTTGTAGG - Intergenic
924819535 1:247475447-247475469 GTCAAAGATCAGATGGTTGTAGG - Intergenic
924919019 1:248606510-248606532 GTCAAAGATCAGATGGTTGTTGG + Intergenic
1063561620 10:7133629-7133651 GTGTGAAATCATAACGTGGTTGG - Intergenic
1064168909 10:13011898-13011920 GTCAAAGATCAGATGGTTGTAGG - Intronic
1064776490 10:18783845-18783867 GTTGAAAATCAGATGGTTGTAGG + Intergenic
1064985172 10:21202759-21202781 AAGAAAAATTAGAAGGTGGAAGG - Intergenic
1065019631 10:21494057-21494079 GGGAAAAAGCAGAAGTTGCTGGG - Exonic
1065392733 10:25200781-25200803 GTCAAAGATCAGATGGTTGTAGG + Intronic
1066785436 10:38998784-38998806 GTGAAAAATCAGAATCTTCTGGG - Intergenic
1067199262 10:44152327-44152349 GTCAAAGATCAGATGGTGGTTGG - Intergenic
1067207039 10:44227248-44227270 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1067207082 10:44227773-44227795 GTCAAACATCAGATGGTAGTAGG - Intergenic
1068055639 10:52009872-52009894 GTCAAACATCAGATGGTTGTAGG - Intronic
1068257954 10:54538400-54538422 GTCAAAAATCAGATGATTGTAGG + Intronic
1068485407 10:57651989-57652011 GTAAAAGATCAGATGGTTGTAGG + Intergenic
1068814957 10:61298871-61298893 GTGAAAAATTAGATGGCTGTAGG + Intergenic
1069044648 10:63729856-63729878 GTCAAACATCAGATGGTTGTAGG - Intergenic
1069465555 10:68635664-68635686 GTGAAGAATGAGAAGGTAGTAGG + Intronic
1071214875 10:83389423-83389445 GTCAAAAATCAGGTGGTTGTAGG + Intergenic
1071283248 10:84122195-84122217 GAGAAAAAACAAAAGGTGGGGGG - Intergenic
1071418881 10:85468934-85468956 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1071661506 10:87506763-87506785 GTGAAAAATTAGAAGTAGGCTGG + Intronic
1072414915 10:95239049-95239071 GTCAAAGATCAGATGGTTGTGGG - Intronic
1073863628 10:107775422-107775444 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1073999157 10:109351003-109351025 GTCAAAAATCAGATGGTTATAGG + Intergenic
1075818991 10:125289403-125289425 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077742846 11:4866784-4866806 GTCAAAGATCAGATGGTTGTAGG - Intronic
1077770452 11:5212656-5212678 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1077792653 11:5458258-5458280 GTCAAAGATCAGATGGTTGTAGG + Intronic
1077955069 11:7009278-7009300 GTTGAAGATCAGATGGTGGTAGG - Intronic
1078032774 11:7770053-7770075 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1078755709 11:14207086-14207108 GTTGAAAATCAGATGGTTGTAGG - Intronic
1078989143 11:16628084-16628106 GTCAAAGATCAGATGGTTGTAGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079578249 11:22029786-22029808 GTCAAAGATCAGACGGTGGTAGG - Intergenic
1079977697 11:27112506-27112528 GTTGAAAATCAGAGGGTTGTAGG - Intronic
1080097557 11:28427224-28427246 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1080167541 11:29257371-29257393 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1080221383 11:29909432-29909454 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1080333805 11:31174013-31174035 CTGAAAACTCAGAAGGGTGTAGG - Intronic
1080680182 11:34468538-34468560 GAAAATAATCAGAAGTTGGTTGG - Intronic
1080801015 11:35610285-35610307 GTGAAAAAACAGAAGTTCTTAGG - Intergenic
1081009056 11:37784970-37784992 GTCAAACATCAGATGGTTGTAGG - Intergenic
1081094564 11:38917060-38917082 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1081272392 11:41100892-41100914 GTCAAAGATCAGATGGTTGTAGG - Intronic
1081342079 11:41940996-41941018 GTCAAATATCAGATGGTTGTAGG - Intergenic
1081389291 11:42510351-42510373 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1082709472 11:56536728-56536750 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1082949814 11:58801498-58801520 GTGAAAGATCAGAGGGTGTGTGG - Intergenic
1083102408 11:60322562-60322584 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1083480359 11:62940579-62940601 GTGAAAAATGAGATAGTGGCTGG - Intronic
1083807041 11:65080638-65080660 GAGAGAAATCAGAAGGTCGCTGG - Intronic
1084601353 11:70147616-70147638 TTGGGAAATCAGAAGGTGGGAGG + Intronic
1084662569 11:70554803-70554825 GTGAAAAATCAGCAGTTGCCAGG - Intronic
1085222496 11:74886917-74886939 GTCAAAGATCAGATGGTTGTAGG - Intronic
1085965933 11:81526409-81526431 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1086029962 11:82342784-82342806 GTCAAATATCAGATGGTTGTAGG - Intergenic
1086201014 11:84202318-84202340 GTCAAAGATCAGATGGTTGTAGG - Intronic
1086447461 11:86883344-86883366 GTCAAAAATCAGATAGTTGTAGG - Intronic
1086526491 11:87733363-87733385 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1086536915 11:87858154-87858176 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1086741547 11:90375747-90375769 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1087060866 11:93976266-93976288 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1087085065 11:94209752-94209774 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1087316582 11:96610404-96610426 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1087439796 11:98168892-98168914 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1087466822 11:98518268-98518290 GTGGAAGATCAGATGGTTGTAGG + Intergenic
1087597718 11:100274072-100274094 GTCGAAAATCAGATGGTTGTAGG - Intronic
1087693017 11:101343924-101343946 GTGGAAAATCAGTTGGTTGTAGG + Intergenic
1087815280 11:102651575-102651597 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1087848705 11:103003523-103003545 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1088149930 11:106732227-106732249 GTCAAAGATCAGATGGTTGTAGG - Intronic
1088385045 11:109244923-109244945 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1088391042 11:109315448-109315470 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1088471518 11:110192237-110192259 GTCAAAAATCAGATGGTTGTAGG - Intronic
1088516723 11:110644506-110644528 GTCAAAGATCAGATGGTTGTAGG - Intronic
1088945530 11:114508593-114508615 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1090658597 11:128864532-128864554 GTGAAATAGCAAAAAGTGGTTGG - Intronic
1090742589 11:129678841-129678863 GTCGAAAATCAGATGGTTGTAGG - Intergenic
1091021197 11:132101646-132101668 GTGAGAAATAAGAAGGTCTTAGG - Intronic
1091662614 12:2395863-2395885 TTGAGAAATTAGAAGGTGCTAGG + Intronic
1091850032 12:3688479-3688501 GTCAAAGATCAGATGGTTGTGGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092512793 12:9175161-9175183 GTCAAAGATCAGATGGTTGTAGG - Intronic
1092569338 12:9705688-9705710 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1092587768 12:9918389-9918411 GTCAAAGATCAGATGGTCGTAGG + Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093360741 12:18224274-18224296 ATGAAAAATCAAAAGGTATTTGG - Intronic
1093548721 12:20380371-20380393 CTGAAAAATCAGAAGCTTATAGG + Intronic
1093589792 12:20888016-20888038 GTCAAAAATCAGTATGTTGTAGG + Intronic
1094059388 12:26297410-26297432 GTCAAAAATCAGAAGATGGAGGG - Intronic
1094206609 12:27846876-27846898 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1094431597 12:30375553-30375575 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1095610649 12:44123691-44123713 GTCAAAGATCAGATGGTTGTAGG + Intronic
1096422728 12:51474170-51474192 CTGAAAAATTAGAATGTGATGGG + Intronic
1096563734 12:52457881-52457903 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1096853178 12:54456298-54456320 GTTAAAGATCAGAAGGTACTTGG - Intronic
1096929616 12:55192310-55192332 GTGAAAGATCAGATGATTGTAGG + Intergenic
1097253208 12:57651185-57651207 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1097320067 12:58215602-58215624 GTCAAAAATCAGATGGTTTTAGG + Intergenic
1097520793 12:60668126-60668148 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1097666565 12:62484037-62484059 TTGAAAATTAAAAAGGTGGTAGG + Intronic
1097948370 12:65398897-65398919 GTCAAAGATCAGAGGGTTGTAGG + Intronic
1098145578 12:67494488-67494510 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1098219253 12:68251416-68251438 GTGAAAAATCACAAAGTGATGGG + Intronic
1098788227 12:74786567-74786589 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1098868700 12:75791242-75791264 GTGAAAAATAATAAGGTAATGGG + Intergenic
1099095625 12:78371316-78371338 GTGACAGATAAGGAGGTGGTTGG - Intergenic
1099130777 12:78827689-78827711 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1099200785 12:79674254-79674276 GTCAAAGATCAGATGGTTGTAGG - Intronic
1099252954 12:80280586-80280608 GTCAAAGATCAGATGGTTGTAGG + Intronic
1099265916 12:80447690-80447712 GTCAAAAATCAGTTGGTTGTAGG + Intronic
1100132839 12:91517758-91517780 GTCAAAAATCAGATGGCTGTAGG - Intergenic
1100556212 12:95696438-95696460 GTGAAAAATCAGAAGATTATTGG - Intronic
1100761159 12:97809062-97809084 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1101241815 12:102846772-102846794 GAAAAAAATCAGAATGTGGTGGG - Intronic
1101280782 12:103253096-103253118 GTCAAAGATCAGATGGTTGTAGG + Intronic
1101344630 12:103875235-103875257 GTCGAAGATCAGATGGTGGTAGG - Intergenic
1101636500 12:106547201-106547223 GTCAAAGATCAGATGGTTGTAGG + Intronic
1101861699 12:108487586-108487608 GTCAAAGATCAGATGGTTGTGGG - Intergenic
1103111251 12:118280485-118280507 GTCAAAGATCAGATGGTTGTAGG + Intronic
1104190108 12:126473247-126473269 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1104225203 12:126825010-126825032 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1104305403 12:127606156-127606178 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1104632587 12:130416424-130416446 GTCAAATATCAGAGGGTTGTAGG - Intronic
1105338243 13:19495137-19495159 GTGAAAAGTGAGGAGGTGATTGG - Intronic
1105580174 13:21688189-21688211 GTGACAAATCAGAAGCTGAGTGG - Intronic
1106005287 13:25764243-25764265 GTCTCAAATAAGAAGGTGGTAGG - Intronic
1106008051 13:25789930-25789952 GTGGAAGATCAGATGGTTGTAGG - Intronic
1106271430 13:28158048-28158070 GTGGAAGATCAGATGGTTGTAGG - Intronic
1106604738 13:31217721-31217743 GTCAAAGATCAGATGGTTGTAGG + Intronic
1106648176 13:31659590-31659612 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1106742162 13:32656115-32656137 GTTGAAAATCAGATGGTTGTAGG + Intronic
1106889788 13:34232488-34232510 GTCAAAAATCAGATGGTTGCAGG + Intergenic
1107324172 13:39223012-39223034 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1107329955 13:39288676-39288698 GTCAAAAATCAGATGGTTGTAGG - Intergenic
1107389571 13:39949780-39949802 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1107568012 13:41626619-41626641 GTCAAATATCAGATGGTTGTAGG - Intronic
1107741758 13:43457813-43457835 GTGAAAAATCATTATGTGATAGG - Intronic
1107779690 13:43885457-43885479 GTCAAAGATCAGATGGTTGTAGG - Intronic
1108239714 13:48450452-48450474 GTCAAAGATCAGATGGTTGTAGG + Intronic
1108653261 13:52502980-52503002 GTGAAAACTGAGGAGGTGATTGG + Intergenic
1108854805 13:54779644-54779666 GTCAAAAATCAGATTGTTGTAGG - Intergenic
1108885052 13:55169996-55170018 GTTGAAAATCAGATGGTTGTAGG - Intergenic
1108983640 13:56554499-56554521 AAGAAAAATAAGAAGGTGGAGGG + Intergenic
1109137595 13:58673910-58673932 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1109374908 13:61479734-61479756 GTCAAAAATCAAACGGTTGTAGG + Intergenic
1109621521 13:64913506-64913528 GTCAAAAATCAGATTGTTGTAGG - Intergenic
1109715251 13:66213376-66213398 GTCAAAGATCAGTTGGTGGTAGG - Intergenic
1109763434 13:66861290-66861312 GTGATAAATCAGAACTTGGAAGG + Intronic
1109799059 13:67350619-67350641 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1109997260 13:70145141-70145163 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1110732907 13:78901278-78901300 GTCAAAAATCAGATGGTTGTAGG - Intergenic
1110876422 13:80516429-80516451 GTCAAATATGAGATGGTGGTAGG + Intergenic
1110900730 13:80820586-80820608 TTTAAAAATAAGAAGATGGTTGG + Intergenic
1111029496 13:82576451-82576473 GTTAAAAATTAGATGGTTGTAGG + Intergenic
1111149688 13:84234064-84234086 GTAAAAGATCAGACGGTTGTAGG - Intergenic
1111166369 13:84462913-84462935 GAAAAAAATCAGAATCTGGTAGG - Intergenic
1111260704 13:85736606-85736628 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1111532713 13:89560339-89560361 GTGGAAGATCAGATGGTTGTAGG - Intergenic
1112255940 13:97831303-97831325 GTTAAAAATCAGGAGATGGTTGG + Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112782785 13:102919716-102919738 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1112817424 13:103289245-103289267 GTGGAAAATCAGTGGGTTGTGGG - Intergenic
1113227361 13:108173938-108173960 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1113430476 13:110245922-110245944 ATGAAAAAGCGTAAGGTGGTGGG - Intronic
1113522103 13:110948474-110948496 GTGAAGAGACAGAGGGTGGTAGG - Intergenic
1114067760 14:19079436-19079458 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1114094497 14:19320590-19320612 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1114361302 14:21976008-21976030 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1114586731 14:23821698-23821720 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1114604153 14:23982654-23982676 GTCAAAAATCTGATGGTTGTAGG - Intronic
1114609176 14:24025453-24025475 GTCAAAAATCTGATGGTTGTAGG - Intergenic
1114706408 14:24731348-24731370 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1114820474 14:26012092-26012114 GAGAAAAATAAGAAGATGGATGG + Intergenic
1114937252 14:27556094-27556116 GTCAAAAATCAGACGGTTGTAGG - Intergenic
1115077321 14:29407527-29407549 GTCAAAAATCAGATGGCTGTAGG + Intergenic
1115283362 14:31689954-31689976 GTTAAAGATCAGATGGTTGTAGG + Intronic
1115346721 14:32350826-32350848 TTTAAAAATCAGAGGATGGTAGG + Intronic
1115652226 14:35410900-35410922 GAGAAAAATCAGAACTTTGTTGG - Intergenic
1115764634 14:36610858-36610880 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1115869306 14:37781917-37781939 GTCAAAGATCAGATGGTTGTAGG + Intronic
1115942497 14:38625057-38625079 GTCAAAGATCAGTTGGTGGTAGG - Intergenic
1116125872 14:40784493-40784515 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1116319942 14:43448763-43448785 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1116575475 14:46568932-46568954 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1116671140 14:47844995-47845017 GTCAAAAATCAGATGTTTGTTGG + Intergenic
1116943555 14:50814741-50814763 GTCAAAGATCAGATGGTTGTAGG - Intronic
1117080423 14:52146139-52146161 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1117829657 14:59737862-59737884 GTCAAAGATCAGATGGTTGTAGG - Intronic
1118325973 14:64780925-64780947 GTCAAAGATCAGATGGTGGTAGG - Intronic
1118900113 14:69979385-69979407 GGCAAAAATGAGAAAGTGGTTGG + Intronic
1119935413 14:78587945-78587967 GTAAAAAATTAGAAAGTGATGGG - Intronic
1120283543 14:82468692-82468714 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1120336005 14:83155921-83155943 GTCAAAGATCAGATGGTTGTGGG - Intergenic
1120588062 14:86340431-86340453 GTCAAAAATCAGATAGTTGTAGG + Intergenic
1121466512 14:94118908-94118930 GTGAATAATCTGAAGGAGCTTGG + Intergenic
1121942578 14:98086601-98086623 GTGGAAGATCAGATGGTTGTAGG + Intergenic
1123214681 14:106796276-106796298 GTCAAAAAACAGATGGTTGTGGG + Intergenic
1124113196 15:26812587-26812609 GTCAAAGATCAGATGGTTGTAGG - Intronic
1124201886 15:27685774-27685796 AGGAAAAATCAGAAAGTGATGGG + Intergenic
1125051263 15:35300181-35300203 GTGAAAAATGAAAAAATGGTAGG + Intronic
1125254699 15:37750108-37750130 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1125342136 15:38685668-38685690 GCGAAACATCAGAAGGTGATGGG + Intergenic
1125780856 15:42266002-42266024 GTTAAATATCAGATGGTTGTAGG + Intronic
1125787707 15:42336333-42336355 GTCAAAGATCAGATGGTTGTAGG - Intronic
1125891797 15:43272606-43272628 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1126476759 15:49073396-49073418 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1126715377 15:51510893-51510915 GTCAAAGATCAGATGGTTGTAGG - Intronic
1126897833 15:53278874-53278896 GTCAAAGATCAGAGGGTTGTGGG - Intergenic
1126956756 15:53941155-53941177 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1126957111 15:53945534-53945556 GTAAAAAATCAGATTGTTGTAGG + Intergenic
1126993430 15:54410647-54410669 GTGAAAGACCAGATGGTTGTAGG + Intronic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127054995 15:55122234-55122256 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1127058430 15:55156383-55156405 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1127231093 15:56996345-56996367 GTCAACAATCAGATGGTTGTAGG - Intronic
1127298934 15:57633897-57633919 GGGAAAAATGAGAACGTTGTTGG - Intronic
1127330607 15:57935727-57935749 GTTAAAGATCAGATGGTTGTAGG + Intergenic
1127374177 15:58367762-58367784 GTCAAAGATCAGATGGTTGTAGG - Intronic
1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG + Intronic
1128895415 15:71368575-71368597 GTCAAAGATCAGATGGTTGTAGG + Intronic
1129965092 15:79727861-79727883 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1130189357 15:81717651-81717673 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1130779566 15:87021194-87021216 GTCAAAGATCAGATGGTTGTAGG - Intronic
1130800527 15:87258048-87258070 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1131555137 15:93391269-93391291 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1132267488 15:100487560-100487582 GTGAACATTCAGAAGTGGGTTGG + Intronic
1133628495 16:7594395-7594417 GTGAAAAATCTGAAAGAGCTGGG + Intronic
1134191935 16:12128406-12128428 GTGAATGATCAGAGTGTGGTGGG + Intronic
1134792806 16:17005534-17005556 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1135911235 16:26562942-26562964 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1136233314 16:28900474-28900496 GTGAAAGGTCAGGAAGTGGTGGG - Intronic
1137018239 16:35396580-35396602 GTGACTAATCAGCAGGTAGTGGG - Intergenic
1137064411 16:35825019-35825041 GTTGAAAATCAGATGGTTGTAGG + Intergenic
1138306884 16:55985593-55985615 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1138676892 16:58657863-58657885 GTCAAAAATGAGAATGGGGTGGG - Intergenic
1138817101 16:60215177-60215199 GTGAAACTTCAGAAGGTGAAGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1138997001 16:62467654-62467676 GTTAAAAATCAGATGGCTGTAGG + Intergenic
1139042571 16:63015779-63015801 GTCAAATATCAGATGGTCGTAGG + Intergenic
1139087920 16:63610974-63610996 GTCAAAAATAAGATGGTTGTAGG + Intergenic
1139263138 16:65614550-65614572 GTCTAAAATCAGATGGTTGTAGG + Intergenic
1139629742 16:68222642-68222664 GTGAAAGTTCATTAGGTGGTAGG - Intronic
1141268354 16:82517111-82517133 GTGACAAATCCGAAGGTTGATGG + Intergenic
1143126528 17:4644720-4644742 CAGAAAAATCAAAATGTGGTGGG + Intergenic
1143191293 17:5042034-5042056 GTGAAAAATTGGAAGTTGGACGG - Intronic
1143505433 17:7362088-7362110 ATGAAAAAGCAGGAGGTGTTTGG + Intergenic
1143983084 17:10887203-10887225 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1143991693 17:10969225-10969247 GTCAAAGATCAGATGGTCGTAGG - Intergenic
1145124929 17:20292311-20292333 ATGAAAAAACAGGCGGTGGTGGG - Intronic
1146751558 17:35386192-35386214 GTGAAATATCTGATGGTTGTAGG + Intergenic
1149063816 17:52456701-52456723 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1149199352 17:54164742-54164764 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1149235445 17:54584945-54584967 GTCAAAGATCAGAAAGTTGTAGG - Intergenic
1149322888 17:55499341-55499363 GTGAAAAAACAGATGGTAGGAGG + Intergenic
1149395324 17:56235644-56235666 GTCAAAGATCAGATGGTTGTAGG + Intronic
1149597177 17:57871173-57871195 GTGAAAAAACAGATTGTGGGAGG - Intronic
1150028448 17:61704170-61704192 GTCAAAGATCAGATGGTTGTAGG + Intronic
1150339895 17:64357945-64357967 GTGAAAAGCCAGAAGATGGAAGG - Intronic
1150537573 17:66059013-66059035 GTCAAAGATCAGATGGTTGTAGG - Intronic
1150965938 17:69968371-69968393 GTGTAAAATCTAATGGTGGTGGG + Intergenic
1151122963 17:71813348-71813370 GTCAAAGATCAGATGATGGTAGG - Intergenic
1151456793 17:74231263-74231285 TTGACAAATCAGAAAGTGTTCGG - Intronic
1151765018 17:76128923-76128945 GTGAAAGAACTGAAAGTGGTTGG + Intergenic
1153176587 18:2380767-2380789 ATTAAAAATCTGAAGGTGTTAGG - Intergenic
1153957042 18:10105816-10105838 GTCAAAAATCAGATGGCTGTAGG + Intergenic
1154222570 18:12469490-12469512 TTAAAAAATCAGAATGTGGCTGG - Intronic
1154349904 18:13574265-13574287 GGGAAAAAGCAGAATGTGGCTGG + Intronic
1154398003 18:14009723-14009745 GTCAAAGATCAGATGGTTGTGGG + Intergenic
1154460406 18:14578570-14578592 GTCAAATATCAGATAGTGGTAGG + Intergenic
1155406547 18:25494638-25494660 CTGATAAAGCAGCAGGTGGTAGG + Intergenic
1155448417 18:25937356-25937378 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1155480420 18:26280641-26280663 GTCAAAAAACAGATGCTGGTGGG + Intronic
1156692246 18:39722263-39722285 CTGATAATTCAGAAGGTGGTGGG + Intergenic
1156985302 18:43343937-43343959 GTGAAAAATGAGTAGGTAGAAGG - Intergenic
1158075414 18:53522619-53522641 GTCAAAGATCAGATGGTTGTAGG - Intronic
1158426042 18:57340422-57340444 GTGAAAAGGCAGAAGGAGCTGGG - Intergenic
1158631328 18:59117349-59117371 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1158738005 18:60105826-60105848 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1158771436 18:60522115-60522137 GTGAAAGATCAGATGGTTGTAGG + Intergenic
1158853859 18:61522765-61522787 GTCAAAGATCAGATGGTTGTAGG - Intronic
1159170703 18:64762684-64762706 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1159395571 18:67851355-67851377 GTCAAAGATCAGATGGTCGTAGG - Intergenic
1159419010 18:68191335-68191357 GTCAAATGTCAGATGGTGGTAGG + Intergenic
1160112735 18:76048855-76048877 GTTAAAAGTCAAAAGGTGGGGGG - Intergenic
1160250053 18:77195080-77195102 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1160361021 18:78278764-78278786 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1162612106 19:11764440-11764462 GTGAAAGATCAGATGGTTGAAGG + Intergenic
1163181126 19:15603318-15603340 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1163231257 19:16004143-16004165 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1163921136 19:20290003-20290025 GTCAAAAATCTGATGGTTGTAGG + Intergenic
1163926899 19:20354343-20354365 GTAAAAAATCTGATGGTTGTAGG - Intergenic
1164043772 19:21515873-21515895 GTCAAATATCAGATGGTCGTAGG + Intronic
1164101757 19:22060914-22060936 GTCAAAGATCAGATGGTTGTAGG + Intronic
1164316572 19:24093576-24093598 GTTAAAGATCAGATGGTTGTAGG + Intronic
1164448647 19:28339446-28339468 GCCAAAAATCAGATGGTTGTAGG + Intergenic
1165041049 19:33067800-33067822 GGCAAAAATCCAAAGGTGGTAGG - Intergenic
1165564856 19:36715950-36715972 GTGAGAAATCAGAATATGGGAGG - Intronic
1165967118 19:39591651-39591673 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1168174110 19:54610459-54610481 GTTAAATATCAGATGGTTGTAGG - Intronic
925320615 2:2964156-2964178 GTCAAAGATCAGATGGTTGTAGG - Intergenic
925322371 2:2983975-2983997 GTCAAAGATCAGATGGTTGTAGG - Intergenic
925453685 2:3994769-3994791 GTCAAAGATCAGACGGTTGTAGG + Intergenic
926545098 2:14230103-14230125 GTCAAAGATCAGATGGTTGTAGG + Intergenic
926986862 2:18633946-18633968 GTTAAAGATCAGATGGTTGTAGG + Intergenic
927871322 2:26626024-26626046 GTCAAAGATCAGATGGTTGTAGG + Intronic
928041450 2:27881769-27881791 GTCAAAGATCAGATGGTTGTAGG - Intronic
928608779 2:32970549-32970571 GTTGAAGATCAGATGGTGGTCGG + Intronic
928800087 2:35078878-35078900 GAGAAAACTAGGAAGGTGGTAGG + Intergenic
929109469 2:38394401-38394423 GTCAAAGATCAGATGGTTGTAGG - Intergenic
929373423 2:41254821-41254843 GTCAAAGATCAGATGGTTGTAGG - Intergenic
929619589 2:43341334-43341356 GAGAAAAATCAGAAGTGGGGTGG + Intronic
930334917 2:50033327-50033349 GTTAAAGATCAGATGGTTGTAGG - Intronic
930437148 2:51359982-51360004 GTTAAAGATCAGACGGTTGTAGG + Intergenic
930501890 2:52232024-52232046 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930516144 2:52410122-52410144 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930594961 2:53376234-53376256 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930673262 2:54173829-54173851 GTCAAAGATCAGATGGTTGTAGG + Intronic
930774791 2:55161140-55161162 GGGAAAAATTAGGTGGTGGTGGG + Intergenic
930839599 2:55830908-55830930 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930943488 2:57042213-57042235 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930981458 2:57530862-57530884 GTCAAAGATCAGATGGTTGTAGG - Intergenic
931069813 2:58633174-58633196 GTGAAAAATTAAAAGGTGGTTGG + Intergenic
931368490 2:61640274-61640296 GTGTAAAAACAGAAGGTGTTGGG + Intergenic
931813770 2:65880214-65880236 GTGAAAAGTGAAAAAGTGGTAGG - Intergenic
932482726 2:72056866-72056888 GTCAAAGATCAGATGGTTGTAGG + Intergenic
932542266 2:72667575-72667597 GTCAAAGATCAGATGGTTGTAGG - Intronic
932778748 2:74546451-74546473 GTGAAAAAGAAGAAAATGGTAGG - Intronic
933018937 2:77166656-77166678 GTCAAAGATCAGATGGTTGTAGG - Intronic
933027725 2:77282694-77282716 GTAAAAAATTAGATGGTTGTAGG - Intronic
933060220 2:77727340-77727362 GTGAATAATCAGAATGTTGAGGG - Intergenic
933144252 2:78831851-78831873 GTGAAAAGTTAGAACTTGGTGGG - Intergenic
933359049 2:81254103-81254125 GTCCAAGATCAGATGGTGGTAGG + Intergenic
933363110 2:81313471-81313493 CTCAAAGATCAGATGGTGGTAGG - Intergenic
933603605 2:84358670-84358692 GTCAAAGATCAGATGGTTGTAGG - Intergenic
933873236 2:86590803-86590825 GTCAAAGATCAGATGGTTGTGGG + Intronic
934996153 2:98962656-98962678 GTCAAAGATCAGATGGTTGTAGG + Intergenic
935122318 2:100193687-100193709 GTTAAAAATCACAAGATGTTTGG - Intergenic
936118774 2:109724058-109724080 GTCAAAGATCAGATGGTTGTAGG + Intergenic
936172491 2:110188847-110188869 GTCAAAGATCAGATGGTTGTAGG - Intronic
936633445 2:114229611-114229633 GTGGAAGATCAGATGGTGGTAGG + Intergenic
936649440 2:114409288-114409310 GTCAAAGATCAGATGGTTGTAGG + Intergenic
937723385 2:125129671-125129693 GTCAAATATCAGATGGTTGTGGG - Intergenic
938485405 2:131702039-131702061 GTCAAAGATCAGATGGTTGTAGG + Intergenic
938623937 2:133088105-133088127 ATGAAAAATAAGTAAGTGGTAGG - Intronic
938751342 2:134333595-134333617 ATAAAAAAAAAGAAGGTGGTGGG + Intronic
938794484 2:134706376-134706398 GTGGAAACTCAGACGCTGGTTGG - Intronic
939111130 2:138008626-138008648 GTCAAAGATCAGATGGTCGTAGG - Intronic
939199179 2:139013185-139013207 GTCAAAGATCAGATGGTTGTAGG + Intergenic
939242422 2:139578382-139578404 GTCAAAAATCAGATGGTTGTAGG - Intergenic
939782014 2:146460614-146460636 GCCAAAGATCAGAAGGTTGTAGG + Intergenic
940056912 2:149523089-149523111 GTGGAAGATCAGATGGTTGTAGG + Intergenic
940208585 2:151232920-151232942 GTCAAAGATCAGATGGTCGTAGG - Intergenic
940222195 2:151364168-151364190 GTGATATATCAGAAGGGGGTTGG - Intronic
940366595 2:152855060-152855082 GTCAAAGATCAGATGGTTGTAGG + Intergenic
940408249 2:153330066-153330088 GTGAAAGTTCAGATGGTTGTAGG + Intergenic
940457559 2:153920333-153920355 GTGGAAGATCAGATGGTTGTAGG - Intronic
940615417 2:156043339-156043361 GTCAAAGATCAGATGGTTGTAGG - Intergenic
940628769 2:156210736-156210758 GTGAAAGATCAGAGGGTTGTAGG + Intergenic
941077826 2:161026300-161026322 ATGAAAGATCAGATGGTTGTAGG - Intergenic
941112869 2:161435858-161435880 GTCAAATATCAGATGGTTGTAGG + Intronic
941566136 2:167110459-167110481 GTCAAAGATCAGATGGTTGTAGG + Intronic
941704824 2:168646821-168646843 GTCAAAGATCAGATGGTCGTAGG + Intronic
942314713 2:174687071-174687093 GTGAAGAATCAGGATGTGTTGGG + Intergenic
942643063 2:178080436-178080458 GTCAAAGATCAGATGGTTGTAGG + Intronic
942793085 2:179783182-179783204 GTCAAAGATCAGATGGTTGTAGG - Intronic
942835094 2:180285855-180285877 GTAAAAAATCAGATGGCTGTAGG - Intergenic
943030265 2:182677721-182677743 GTCAAAGATCAGATGGTTGTAGG - Intergenic
943074280 2:183175655-183175677 GTCAAAGATCAGATGGTTGTAGG + Intergenic
943307382 2:186280457-186280479 GTTGAAAATCAGATGGTTGTAGG + Intergenic
943352905 2:186816662-186816684 GTCAAAGATCAGATGGTTGTAGG - Intergenic
943505780 2:188755621-188755643 GTCAAAAATCAGATGGTTGTAGG + Intronic
943629875 2:190239254-190239276 GTCAAAGATCAGATGGTTGTAGG + Intronic
944000494 2:194830378-194830400 ATGAAAAATCAGACCATGGTTGG - Intergenic
944327766 2:198426913-198426935 GTCAAAGATCAGATGGTTGTAGG + Intronic
944360751 2:198853197-198853219 GTCAAAGATCAGATGGTTGTGGG - Intergenic
944371006 2:198984012-198984034 GTCAAAGATCAGATGGTTGTAGG - Intergenic
944622200 2:201527609-201527631 GTCAAAAATCAGATGGATGTAGG - Intronic
944929381 2:204500928-204500950 GGGAAAATTAAGAAGATGGTGGG + Intergenic
945523190 2:210854771-210854793 GTCAAAGATCAGATGGTTGTAGG + Intergenic
945734050 2:213576213-213576235 GTCAAAAATCAGATAGTTGTAGG + Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947060489 2:226159214-226159236 CTCAAAAATCAGATGGTTGTAGG - Intergenic
947154343 2:227146380-227146402 GTGAAAGAAGTGAAGGTGGTGGG - Intronic
947198191 2:227590224-227590246 GTCAAAGATCAGATGGTTGTAGG + Intergenic
947281129 2:228456220-228456242 GTCAAAAATCAGATGGTTGTAGG + Intergenic
947515869 2:230804099-230804121 GTCAAAGATCAGATGGTTGTAGG - Intronic
1169024745 20:2359979-2360001 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1169371829 20:5033907-5033929 AAGAAAAATCAGAAAGTGGGTGG - Intergenic
1170331219 20:15213019-15213041 GTGCAAAAAGAAAAGGTGGTTGG + Intronic
1170514218 20:17111125-17111147 GTCAAAAATCAGATAGTTGTAGG + Intergenic
1170518313 20:17154803-17154825 GAGAAAAATCATACAGTGGTAGG - Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1171112617 20:22498084-22498106 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1171231177 20:23487058-23487080 ATCAAAGATCAGATGGTGGTAGG + Intergenic
1171275358 20:23852188-23852210 GTGAAAACTGAGGGGGTGGTAGG - Intergenic
1171325429 20:24287527-24287549 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1171937702 20:31291476-31291498 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172363017 20:34327441-34327463 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG + Intergenic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174660225 20:52205937-52205959 ATGAAAAATCAGAAGGTAGGTGG - Intergenic
1176665424 21:9682583-9682605 GTGAAAAATGACAAACTGGTAGG + Intergenic
1176735313 21:10540739-10540761 GTGAAAAGTGAGGAGGTGATTGG + Intronic
1176898402 21:14410982-14411004 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1178186846 21:30231991-30232013 GTCAAAGATCAAATGGTGGTAGG - Intergenic
1179003873 21:37491958-37491980 GATTAGAATCAGAAGGTGGTAGG + Intronic
1179020815 21:37639207-37639229 GTGAAAAATCAAAGGAGGGTGGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180486235 22:15802005-15802027 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1180577841 22:16797021-16797043 GTCAAAGATCAGATGGTTGTAGG - Intronic
1182195445 22:28511358-28511380 GTAAAAGATCAGATGGTTGTAGG - Intronic
1182606304 22:31507206-31507228 GTCAAAGATCAGATGGTTGTAGG - Intronic
1183454801 22:37916743-37916765 GTGGGAAATCAGAAAGGGGTTGG + Intronic
1183533773 22:38382332-38382354 GTGAAAAGTGAGGAGGTGATTGG - Intronic
1183733159 22:39629493-39629515 GTGATAAACCGGAAGATGGTGGG - Intronic
1183981270 22:41541928-41541950 GTGGAGCATCAGAAGGTGATGGG - Intronic
1184976094 22:48063527-48063549 GTCAAAGATCAGATGGTTGTAGG - Intergenic
949633461 3:5955532-5955554 GTGAAACATCAGATGATTGTAGG + Intergenic
949799009 3:7882870-7882892 GTGGAAGATCAGATGGTTGTAGG - Intergenic
949861532 3:8509710-8509732 CTGGAAAATCTGAGGGTGGTTGG - Intronic
950175388 3:10869876-10869898 GTGTAACTTCAGAAGGTAGTTGG + Intronic
950608076 3:14102233-14102255 GTCAAAGATCAGATGGTTGTAGG - Intergenic
950820574 3:15753940-15753962 CTCAAAAAACAGAAGGTGGCTGG + Intronic
951181483 3:19664406-19664428 GTCAAAGATCAGATGGCGGTAGG - Intergenic
951395068 3:22154699-22154721 GTTAAAAATTAAAAGGAGGTGGG - Intronic
951440613 3:22719013-22719035 GTCAAAGATCAGATGGTTGTGGG - Intergenic
951650499 3:24946400-24946422 TTTAGAAATTAGAAGGTGGTGGG + Intergenic
951920001 3:27843893-27843915 GTCAAATATCATAAGGTGATTGG - Intergenic
952050129 3:29375060-29375082 GTCAAAGATCAGATGGTTGTAGG - Intronic
952664696 3:35890140-35890162 GTCAAAAATCAGTTGGTAGTTGG + Intergenic
953018687 3:39100400-39100422 GTGGTAGAGCAGAAGGTGGTGGG + Exonic
953058146 3:39404791-39404813 GTGAACACTCAGAGGGTGGAGGG + Intergenic
953187104 3:40648267-40648289 GTGTAAAACCAGATGGTGCTTGG + Intergenic
953491639 3:43357648-43357670 GTCAAAGATCAGATGGTTGTAGG - Intronic
953917162 3:46927425-46927447 GTGAGAAATCAGAAGGAGAGAGG + Intronic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
955174605 3:56601263-56601285 GTCAAAGATCAGATGGTTGTGGG + Intronic
955180066 3:56659451-56659473 GTCAAACATCAGATTGTGGTGGG - Intronic
955471714 3:59293648-59293670 GTCAAAGATCAGATGGTTGTAGG + Intergenic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
955886335 3:63602636-63602658 GTCAAAGATCAGATGGTTGTAGG + Intronic
956301486 3:67776897-67776919 GTCAAAAATCAGGTGGTTGTAGG + Intergenic
956896395 3:73665037-73665059 GTGAAAAGACAGAAGGTGGCTGG - Intergenic
957105037 3:75876105-75876127 GTCAAAGATCAGATGGTTGTAGG - Intergenic
957188631 3:76976757-76976779 GTGCAAAATAAGAATGTGTTTGG - Intronic
957339568 3:78878028-78878050 GTGAAAATTGATAAGGTGATGGG - Intronic
957446433 3:80317765-80317787 GTCAAAGATCAGATGGTTGTAGG - Intergenic
957491925 3:80938762-80938784 TTGAAATCTCAAAAGGTGGTTGG - Intergenic
957542673 3:81593977-81593999 GTCAAACATAAGATGGTGGTTGG - Exonic
957804404 3:85128580-85128602 ATGACAAGTCAGAAGGTGGAAGG + Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958082412 3:88763209-88763231 GTAAAAAATCAGATAGTAGTAGG + Intergenic
958088731 3:88848390-88848412 GTCAAAAATCAGATGATTGTAGG + Intergenic
958089326 3:88856099-88856121 GTGAAAGATCAGTTGGTTGTAGG + Intergenic
958173175 3:89962540-89962562 GTCAAAGATCAGAAAGTTGTAGG - Intergenic
958562786 3:95769387-95769409 GTGAAAGATCAGATGGTTGTAGG - Intergenic
958769836 3:98413015-98413037 GTCAAAGATCAGATGGTTGTAGG - Intergenic
958854552 3:99368801-99368823 GTCAAAGATCAGATGGTTGTAGG + Intergenic
958870848 3:99557192-99557214 GTCAAAGATCAGATGGTTGTAGG - Intergenic
959390696 3:105769904-105769926 GAGACTAATCAGAAGGTTGTTGG + Intronic
959392727 3:105796294-105796316 GTCAAAGATCAGATGGTTGTAGG - Intronic
960234658 3:115267938-115267960 GTTGAAAATCAGATGGTTGTAGG - Intergenic
960306927 3:116073197-116073219 GTCAAAGATCAGATGGTTGTAGG + Intronic
960346837 3:116543455-116543477 GTTGAAAATCAGATGGTTGTTGG - Intronic
960489154 3:118290807-118290829 GTGAAAGATCAGATGGTTGTAGG + Intergenic
960681647 3:120254154-120254176 GTCAACAGTCAGATGGTGGTAGG - Intronic
960756057 3:121013928-121013950 GTCAAAGATCAGATGGTTGTAGG + Intronic
960858770 3:122130004-122130026 GTCAAATATCAGATGGTTGTAGG - Intergenic
961096980 3:124165900-124165922 GTGAACAAGCAGGAAGTGGTAGG - Intronic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961332915 3:126153592-126153614 GAGAAATATCAGAAGATGGTGGG + Intronic
961590625 3:127978117-127978139 GTTGAAAATCAGATGGTTGTAGG + Intronic
961932627 3:130549681-130549703 GTCAAAGATCAGATGGTTGTAGG + Intergenic
962257121 3:133880115-133880137 GTCAAAGATCAGATGGTGGTGGG - Intronic
962385465 3:134929036-134929058 GTGAAGAGTCAGTAGGAGGTGGG + Intronic
962470230 3:135700922-135700944 GTCAAAGATCAGATGGTTGTGGG - Intergenic
962510040 3:136089372-136089394 GTCAAATATCAGATGGTTGTAGG + Intronic
962657153 3:137558863-137558885 GTTAAAAATCAGATGGCTGTAGG - Intergenic
962681588 3:137806169-137806191 GTGAAAAATCAGAAAGTTTTAGG - Intergenic
962691553 3:137903930-137903952 GTCAAAGATCAGATGGTTGTAGG - Intergenic
962981574 3:140495754-140495776 GTCAAAGATCAGATGGTTGTAGG + Intronic
962983539 3:140512407-140512429 GTCAAAGATCAGACGGTTGTAGG + Intronic
962997457 3:140644904-140644926 GTCAAAGATCAGATGGTTGTAGG + Intergenic
963032468 3:140992365-140992387 GTCAAAGATCAGATGGTTGTAGG - Intergenic
963050280 3:141136630-141136652 GTCAAAGATCAGATGGTTGTAGG + Intronic
963089441 3:141468932-141468954 GTCAAAAATCAGTTGGTTGTAGG + Intergenic
963610562 3:147462290-147462312 GTGAAAAATATGAAGCTGCTTGG - Intronic
963862018 3:150321756-150321778 GTCAAAGATCAGATGGTTGTAGG + Intergenic
964214789 3:154267416-154267438 GTCAAAAATCAGATGGTTGTAGG - Intergenic
964458452 3:156894743-156894765 GTCAAAGATCAGATGGTTGTAGG - Intronic
964581440 3:158243339-158243361 GTCAGAGATCAGATGGTGGTAGG + Intronic
964902810 3:161680328-161680350 GTGAAAATTCAGTTGGTGGGTGG + Intergenic
964909253 3:161758072-161758094 GAGAAAGAGAAGAAGGTGGTTGG + Intergenic
964987429 3:162761560-162761582 GTCAAAGATCAGATGGTTGTAGG + Intergenic
965048424 3:163611410-163611432 GTCAAACATCAGAGGGTTGTAGG + Intergenic
965249512 3:166325040-166325062 GTCAAAGATCAGACGGTTGTAGG + Intergenic
965343982 3:167524696-167524718 GTCAAAGATCAGATGGTTGTAGG + Intronic
965747262 3:171938450-171938472 GAGACATATCAGAAGGTGGCAGG + Intronic
966137029 3:176710394-176710416 GTCAAAGATCAGATGGTTGTTGG - Intergenic
966150819 3:176866111-176866133 GTCAAAGATCAGATGGTTGTTGG - Intergenic
966476635 3:180356173-180356195 GTGAAAAATCAGTATGTAGTGGG - Intergenic
966500819 3:180636780-180636802 GTTAAAGATGAGATGGTGGTAGG - Intronic
966569857 3:181429338-181429360 GTCAAAAACCAGAATGTAGTGGG + Intergenic
966583268 3:181592187-181592209 GTCAAAGATCAGATGGTTGTAGG + Intergenic
966768787 3:183485695-183485717 GTGAAAAATGACAAAGTGTTGGG - Intergenic
968260048 3:197314104-197314126 GTCAAAGATCAGATGGTTGTAGG + Intergenic
969159410 4:5242868-5242890 GTCAAAGATCAGATGGTTGTAGG + Intronic
970836236 4:20410707-20410729 GTTAAAGATCAGATGGTTGTAGG + Intronic
970875692 4:20867375-20867397 GTCAAAGATCAGACGGTGGTAGG - Intronic
971140433 4:23919446-23919468 GTGTAAAATCATAGGATGGTAGG - Intergenic
971345221 4:25805996-25806018 GTGAAAAATTAAAATGTTGTGGG + Intronic
971548941 4:27924697-27924719 GAGAAAACTCAGAAACTGGTGGG - Intergenic
971550561 4:27950571-27950593 GTTAAAAATCAAATGGTTGTAGG - Intergenic
971690544 4:29828882-29828904 GTGAAAAGTTAAAAGGTGGGGGG + Intergenic
971800329 4:31281632-31281654 GTGAAAGATCAGTTGGTTGTAGG - Intergenic
971952829 4:33377011-33377033 GTGAAAAAAAAGAAGTCGGTTGG + Intergenic
971989748 4:33877019-33877041 GTCAAAGATCAGATGGTTGTAGG + Intergenic
972103617 4:35453617-35453639 GTGTAACAGCAGAAGTTGGTAGG + Intergenic
972190961 4:36589962-36589984 GTTAAAGATCAGATGGTTGTAGG + Intergenic
972289897 4:37681821-37681843 GTCAAAAATCAGAAGGAAGCCGG - Intronic
973661358 4:53110092-53110114 GTTAAAGATCAGATGGTTGTAGG - Intronic
974094497 4:57348238-57348260 GTCAAAGATCAGATGGTTGTAGG + Intergenic
974297115 4:60014811-60014833 GTCAAATATCAGATGGTTGTGGG + Intergenic
974342476 4:60632271-60632293 GTCAAAGATCAGATGGTTGTAGG + Intergenic
974350067 4:60733053-60733075 GTCAAAGATCAGATGGTTGTAGG + Intergenic
974450971 4:62058779-62058801 TTTACAAATCAGAAGCTGGTTGG + Intronic
974650168 4:64744760-64744782 GTCAAAGATCAGATGGTTGTAGG + Intergenic
974704960 4:65501952-65501974 GTAAAAGATCAAAAGGTTGTAGG - Intronic
975022951 4:69513374-69513396 GTGGAAGATCAGATGGTTGTAGG + Intronic
975026454 4:69554956-69554978 GTTAAAGATCAGATGGTTGTAGG - Intergenic
975360852 4:73469953-73469975 GTCAAAGATCAGATGGTTGTAGG + Intergenic
975390197 4:73807315-73807337 GTCAAAGATCAGATGGTTGTAGG - Intergenic
975563976 4:75734426-75734448 GTCAAAGATCAGATGGTTGTAGG + Intronic
975889606 4:79011556-79011578 GTGAAAGATGAGATGGTTGTAGG - Intergenic
975902508 4:79169456-79169478 GTCAAAGATCAGATGGTTGTAGG - Intergenic
976452994 4:85213494-85213516 TTAAAAAATCAGATGGTTGTAGG + Intergenic
976900481 4:90168766-90168788 GTCAAAGATCAGATGGTTGTAGG + Intronic
976979457 4:91208517-91208539 GTCAAACATCAGATGGTTGTAGG + Intronic
977505534 4:97898194-97898216 GTCAAAGATCAGATGGTTGTAGG + Intronic
977896103 4:102367032-102367054 GTCAAAGATCAGATGGTTGTAGG - Intronic
977971939 4:103223346-103223368 GTCAAAGATCAGATGGTTGTAGG - Intergenic
977999627 4:103541337-103541359 GTGAAAGATCAGATGGTTCTAGG + Intergenic
978022743 4:103833767-103833789 GTCAAAGATCAGATGGTTGTAGG + Intergenic
978118907 4:105054628-105054650 GTTAGATATCAGATGGTGGTAGG - Intergenic
978148197 4:105402568-105402590 GTGAAAAAACAGAAAGTATTAGG + Intronic
978452782 4:108854068-108854090 GTCAAAGATCAGATGGTTGTAGG - Intronic
979019366 4:115476612-115476634 GTCAAAGATCAGATGGTTGTAGG - Intergenic
979310387 4:119196520-119196542 GTCAAAAAACAGATGGTTGTAGG - Intronic
979576418 4:122296767-122296789 GTCAAAGATCAGATGGTTGTAGG - Intronic
980392523 4:132165183-132165205 GTCAAAGATCAGATGGTTGTAGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980664128 4:135906249-135906271 GTTAAAGATCAGATGGTTGTAGG + Intergenic
980665672 4:135930627-135930649 GTCAAAAATCAGATGGTGGTAGG - Intergenic
980824850 4:138060908-138060930 GTGAAAGATCAGATGGTTGTAGG + Intergenic
980858612 4:138471210-138471232 GTCAAAGATCAGATGGTTGTAGG + Intergenic
980873987 4:138642046-138642068 GTGAAGCTTCACAAGGTGGTGGG - Intergenic
981181293 4:141748761-141748783 GTCAAAGATCAGATGGTTGTAGG - Intergenic
981512300 4:145571167-145571189 GTCAAAGATCAGATGGTTGTAGG - Intergenic
981790556 4:148531740-148531762 GTCAAAGATCAGATGGTTGTCGG + Intergenic
981878406 4:149577521-149577543 GTCAAAGATCAGATGGTTGTAGG + Intergenic
981885666 4:149669767-149669789 GTCAAAGATCAGACGGTTGTAGG + Intergenic
982432013 4:155333850-155333872 GTCAAAGATCAGATGGTTGTAGG - Intergenic
982734314 4:158989581-158989603 GTCAAAGATCAGATGGTTGTAGG - Intronic
982747124 4:159115785-159115807 GTCAAAGATCAGATGGTTGTAGG - Intronic
983058001 4:163122364-163122386 GTGACAAATCACAATTTGGTGGG + Intronic
983441561 4:167793086-167793108 GTCAAAGATCAGATGGTTGTAGG + Intergenic
983675179 4:170283920-170283942 GATAAAAATCAGAATGTGTTTGG + Intergenic
983778141 4:171634161-171634183 GTCAAATATCAGATGGTTGTAGG + Intergenic
983899437 4:173118056-173118078 GTCAAAGATCAGATGGTTGTAGG - Intergenic
984202196 4:176738402-176738424 GTCAAAAGTCAGATGGTTGTAGG - Intronic
984346337 4:178532164-178532186 TTGTAAAATCAGAAGGTGTGTGG + Intergenic
984372833 4:178888780-178888802 GTCAAAGATCAGATGGTTGTAGG - Intergenic
984715696 4:182922809-182922831 GTAGAAAGTCAGAATGTGGTAGG + Intergenic
985093508 4:186388813-186388835 GTCAAAGATCAGACGGTTGTAGG - Intergenic
985301038 4:188489822-188489844 GTCAAAGATCAGATGGTTGTTGG + Intergenic
985341759 4:188961904-188961926 GAGAAAAATCTGAACCTGGTTGG - Intergenic
986599817 5:9461557-9461579 GTAAAAAATCAGAAGATGATGGG - Intronic
986753959 5:10816792-10816814 GTCAAAGATCAGATGGTTGTAGG - Intergenic
987092412 5:14520139-14520161 GTCAAAGATCAGATGGTTGTAGG + Intronic
987270073 5:16298538-16298560 GTGGAAGATCAGATGGTTGTAGG - Intergenic
987291676 5:16514238-16514260 GTTAAAAATAAGAATGTGGGAGG - Intronic
987460671 5:18205515-18205537 GTCAAAGATCAGATGGTTGTAGG + Intergenic
987463453 5:18243845-18243867 GTGCACAGTGAGAAGGTGGTAGG - Intergenic
987860958 5:23487351-23487373 GTAGAAAATCAGATGGTTGTAGG + Intergenic
987889073 5:23852912-23852934 GTTAAAAATCAGAAGATTGTAGG + Intergenic
987997754 5:25308071-25308093 GTCAAAGATCAGATGGTTGTAGG + Intergenic
988001928 5:25360256-25360278 GTCAAAGATCAGATGGTTGTAGG - Intergenic
988057719 5:26121840-26121862 GGGAAAAATTAGAAGGATGTGGG - Intergenic
988976187 5:36518314-36518336 GTCAAAGATCAGATGGTTGTAGG - Intergenic
989432120 5:41367930-41367952 GTCAAAAATCAGATGGTTGTAGG + Intronic
989447732 5:41550447-41550469 GTCAAAAATCAGATGGTTGTAGG - Intergenic
989455861 5:41643369-41643391 GTCAAAGATCAGATGGTTGTAGG - Intergenic
990195149 5:53306436-53306458 GTCAAAGATCAGATGGTTGTAGG + Intergenic
990214936 5:53520027-53520049 GTCAAAAATCAGAAGCTTGTAGG - Intergenic
990230501 5:53708005-53708027 GTAAAAAATCAGATAGTTGTAGG + Intergenic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
990343644 5:54849883-54849905 GTTTAATATCAGAGGGTGGTGGG + Intergenic
990434025 5:55769406-55769428 GGCAAAAATCAGATGGTTGTAGG + Intronic
990735034 5:58851048-58851070 GTGAGACATCAGTGGGTGGTAGG - Intronic
990923011 5:60988630-60988652 GTCAAAGATCAGATGGTTGTAGG - Intronic
991224694 5:64256492-64256514 GTCAAAGATCAGATGGTTGTAGG + Intronic
991917359 5:71618357-71618379 GTGGAACAGCAGAAGGTGGGAGG - Intronic
992125112 5:73631924-73631946 GTAAAAAATGAGAGGGTGGTAGG - Intronic
992446233 5:76836732-76836754 GTGAGAAATGAGAAAATGGTGGG + Intergenic
993019077 5:82569156-82569178 GTCAAAGATCAGAAGGTTGTAGG - Intergenic
993247618 5:85470915-85470937 GTGAAAAAAAAGAAGGCGGCTGG + Intergenic
993286655 5:86007879-86007901 GTCAAAGATCAGATGGTGGTAGG + Intergenic
993336061 5:86660315-86660337 GTCAAAGATCAGAGGGTTGTAGG + Intergenic
993389776 5:87305349-87305371 GTCAAAAATCAGATAGTTGTAGG - Intronic
993655537 5:90573940-90573962 GTCAAAGATCAGATGGTTGTAGG + Intronic
993779954 5:92054237-92054259 GTCAAAAATCAGATAGTTGTAGG + Intergenic
993821387 5:92621329-92621351 GTCAAAGATCAGATGGTTGTAGG + Intergenic
993952857 5:94197761-94197783 GTCAAAGATCAGATGGTTGTAGG + Intronic
994060769 5:95474199-95474221 GTCAAAGATCAGATGGTTGTAGG + Intronic
994119553 5:96098613-96098635 GTCAAAGATCAGATGGTTGTAGG + Intergenic
994129312 5:96206594-96206616 GTCAAAGATCAGATGGTTGTAGG + Intergenic
994409111 5:99383958-99383980 GTAAAAGATCAGATGGTTGTAGG - Intergenic
994650880 5:102525725-102525747 GTTGAAAATCAGATGGTTGTAGG - Intergenic
994957438 5:106551455-106551477 GTGGAAGACCAGATGGTGGTAGG - Intergenic
995255499 5:110041315-110041337 GTTAAAGATCAGATGGTTGTAGG + Intergenic
995257897 5:110068245-110068267 GTAAAAGATCAGATGGTTGTAGG + Intergenic
995350710 5:111172242-111172264 GTAAAAAATGAAAAGATGGTTGG - Intergenic
995703825 5:114964322-114964344 GTCAAAGATCAGATGGTGGTAGG + Intergenic
996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG + Intergenic
996055474 5:118978053-118978075 GTGGAAGATCAGATGGTTGTAGG - Intronic
996106068 5:119505040-119505062 GTCAAAGATCAGATGGTTGTAGG + Intronic
996395148 5:123006282-123006304 TTGCATAATCAGAGGGTGGTGGG - Intronic
996633254 5:125662717-125662739 GTCAAAGATCAGATGGTTGTAGG + Intergenic
996778078 5:127154664-127154686 GTCAAAGATCAGATGGTTGTAGG + Intergenic
997017765 5:129956754-129956776 GTGAAAGCTCAGATGGTTGTAGG + Intronic
997053201 5:130407706-130407728 GTCAAAGATCAGATGGTTGTAGG + Intergenic
997076226 5:130681043-130681065 GTCAAAGATCAGATGGTTGTAGG - Intergenic
997204658 5:132038993-132039015 GTCAAAGATCAGATGGTTGTAGG + Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997763485 5:136474181-136474203 GTCAAAGATCAGATGGTTGTAGG - Intergenic
998776159 5:145605463-145605485 GTCAAAGATCAGATGGTTGTAGG + Intronic
998922842 5:147088738-147088760 GTCAAAGATCAGATGGTTGTAGG + Intergenic
999853347 5:155566625-155566647 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1000421090 5:161038746-161038768 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1000804876 5:165777379-165777401 GTGTAAAATCAGAATGTTTTAGG - Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003200243 6:3953050-3953072 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1005885912 6:30097584-30097606 GTGAAAAATGGGAAGCAGGTGGG + Intergenic
1005924155 6:30427763-30427785 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006771878 6:36560520-36560542 GTGAAGAGTCAGAAGGTAGGAGG - Intergenic
1007188214 6:39990891-39990913 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1007872767 6:45060299-45060321 GTCAAATATCAGATGGTTGTAGG - Intronic
1008303805 6:49875749-49875771 GTCAAAGATCAGATGGTTGTAGG - Intronic
1009244720 6:61222567-61222589 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1009382689 6:63052637-63052659 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1009495404 6:64340421-64340443 GTTAAAAATCAGTTGGTTGTAGG - Intronic
1009805442 6:68596229-68596251 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1009818440 6:68768390-68768412 GTCAAAGATCAGATGGTTGTAGG - Intronic
1009915640 6:69992188-69992210 GTCGAAAATCAGATGGTTGTAGG + Intronic
1010019978 6:71148139-71148161 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1010432847 6:75798273-75798295 GTCAAAAATCAGATGGTTGTAGG + Intronic
1010531252 6:76970060-76970082 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1010562787 6:77371228-77371250 ATGAAGAATAAGTAGGTGGTAGG - Intergenic
1010670527 6:78681147-78681169 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1010775698 6:79882685-79882707 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1010892925 6:81336481-81336503 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1011074078 6:83419264-83419286 TTAAAAAAACAAAAGGTGGTGGG + Intronic
1011320246 6:86083433-86083455 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1011921440 6:92581842-92581864 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1011985256 6:93435755-93435777 GTGAAAGATCAGATGGTTGTAGG - Intergenic
1012135929 6:95555750-95555772 GTCAAAGATCAGATGGTCGTAGG + Intergenic
1012143058 6:95647702-95647724 GTCAAAAATCAGATGGTTATAGG - Intergenic
1012250893 6:96979428-96979450 GTCAAAGATCAGATGGTTGTAGG + Intronic
1012533017 6:100261328-100261350 GTGGACAATCAGAAGGATGTGGG - Intergenic
1012688737 6:102287142-102287164 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1012810126 6:103946511-103946533 GTCAAAAATCAGATGATTGTAGG + Intergenic
1012871318 6:104675911-104675933 GTCAAAGATCAGACGGTTGTAGG - Intergenic
1013158954 6:107522869-107522891 GTGATTAATCAGAATGTGGGAGG + Intronic
1014029764 6:116686824-116686846 GTCAAAGATCAGATGGTTGTAGG + Intronic
1014367652 6:120564012-120564034 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1014958455 6:127651946-127651968 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1015000124 6:128204125-128204147 GTCAAAGATCAGATGGTTGTAGG - Intronic
1015356649 6:132285279-132285301 GTGGAAAAGCACAAGGTGTTAGG - Intergenic
1015390683 6:132678114-132678136 GTAAAAAATCATATGGTTGTAGG + Intergenic
1016005584 6:139085710-139085732 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1016088852 6:139950425-139950447 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1016291471 6:142532903-142532925 GTTAAATATCATCAGGTGGTTGG + Intergenic
1016565049 6:145442706-145442728 GTCAAAGATCAGATGGTAGTAGG + Intergenic
1016847532 6:148583184-148583206 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1017221209 6:151968121-151968143 GTCAAAGATCAGATGGTTGTAGG - Intronic
1017327459 6:153155758-153155780 ATAACAAATAAGAAGGTGGTGGG + Intergenic
1017612667 6:156207219-156207241 GTTGAAGATCAGATGGTGGTAGG - Intergenic
1018096846 6:160394944-160394966 GTGCAAAATCAGAAGGTAGGAGG - Intronic
1018125131 6:160675205-160675227 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1018375346 6:163205415-163205437 GTCAAAGATCAGATGGTTGTAGG - Intronic
1018477176 6:164154865-164154887 GTCAAAAATCAGTTGGTTGTAGG - Intergenic
1018574034 6:165239607-165239629 GTCAAAGATCAGTTGGTGGTAGG + Intergenic
1018578674 6:165287634-165287656 GTCAAAGATCAGATGGTTGTAGG - Intronic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1020637508 7:10714322-10714344 CTCGAAACTCAGAAGGTGGTGGG - Intergenic
1020914876 7:14180363-14180385 GAAAAAAATCAGAAGGAGGGTGG - Intronic
1021754509 7:23838479-23838501 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1022167548 7:27784673-27784695 ATGAAAAGTCTGAAGGTGGGGGG + Intronic
1022370778 7:29769365-29769387 GTGGAAGATCAGATGGTTGTAGG - Intergenic
1022669683 7:32444103-32444125 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1022704797 7:32792328-32792350 TTGAAAAATCATAATGTGGGAGG + Intergenic
1022764580 7:33396854-33396876 GTCAAAGATCAGATGGTTGTAGG - Intronic
1022910132 7:34892931-34892953 TTGAAAAATCATAATGTGGGAGG + Intergenic
1023195798 7:37637592-37637614 GTTAAAGATCAGATGGTTGTAGG + Intergenic
1023329766 7:39102336-39102358 GTAAAAAATGAGAAAGTAGTTGG - Intronic
1025775382 7:64556485-64556507 GTGGAAGATCAGATGGTTGTAGG - Intronic
1026341263 7:69436175-69436197 AAGAAAAATAAGAAGGTGGATGG - Intergenic
1027299321 7:76813714-76813736 GAGGAAAATCAGATGGTTGTAGG + Intergenic
1027399880 7:77796688-77796710 GAAAAAGATCAGAAGGTGCTAGG + Intronic
1027705614 7:81529661-81529683 GTGGAAGATCAGATGGTTGTAGG - Intergenic
1027927272 7:84482630-84482652 GGGAAAAATGTGAATGTGGTGGG - Intronic
1028609218 7:92690409-92690431 GTTAAAAATCAGACAGTTGTAGG + Intronic
1028640270 7:93034616-93034638 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1029063911 7:97828685-97828707 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1030293526 7:107896073-107896095 GTGAGTAAACAGAACGTGGTAGG + Intronic
1030378750 7:108786639-108786661 GTCAAAGATCAGATGGTCGTAGG - Intergenic
1030413379 7:109210774-109210796 GTTAAAGATCAGATGGTTGTAGG + Intergenic
1030718837 7:112844946-112844968 GTCAAAAATCAGATGGTCATAGG - Intronic
1031214033 7:118867893-118867915 GTGGAAAATAAGAACGTGTTGGG - Intergenic
1031255663 7:119444774-119444796 ATAAAAAATCAGATGGTTGTAGG + Intergenic
1031444636 7:121836001-121836023 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031469565 7:122152965-122152987 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031542713 7:123014465-123014487 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031550748 7:123109261-123109283 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031737435 7:125384122-125384144 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1032361579 7:131260844-131260866 GTCAAACATCAGATGGTTGTAGG - Intronic
1032778372 7:135139862-135139884 GTCAAAGATCAGATGGTTGTAGG + Intronic
1032912719 7:136452093-136452115 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1033033538 7:137848542-137848564 GTGAAAAATCAGAAGTATTTTGG - Intergenic
1033413648 7:141143507-141143529 GTCAAAGATCAGATGGTTGTAGG + Intronic
1033455437 7:141498984-141499006 CTTAAAAAGCAGAGGGTGGTTGG + Intergenic
1033776054 7:144613375-144613397 GTCAAAAATCAGATGGTTATAGG + Intronic
1033882678 7:145904971-145904993 GTGAACAATCAACAGGTAGTAGG + Intergenic
1034257492 7:149732671-149732693 GAGTAAAAGCAGAAGGGGGTGGG + Intronic
1035042230 7:155937431-155937453 GTGAAAAGTCAGCAGCTGGAAGG + Intergenic
1036436629 8:8740591-8740613 GTCAAATATCAGATGGTTGTAGG - Intergenic
1036438729 8:8760808-8760830 ATGGAAAATCCCAAGGTGGTGGG - Intergenic
1037033725 8:14141022-14141044 GTCAAAGATCAGATGGTTGTAGG - Intronic
1037388714 8:18369689-18369711 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1038374864 8:27029726-27029748 TGGAAACATCAGAAGATGGTAGG - Intergenic
1038519908 8:28222168-28222190 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1038809011 8:30820898-30820920 TTGAAAAATCAGATGGCTGTAGG + Intergenic
1038859047 8:31365656-31365678 GTCAAAGATCAGATGGTCGTAGG + Intergenic
1039707009 8:40017689-40017711 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1040091109 8:43399830-43399852 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1040350789 8:46565227-46565249 GTGAAAGACCAGATGGTTGTAGG - Intergenic
1040533518 8:48285501-48285523 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1041655269 8:60343266-60343288 GTAAAAGATCAGATGGTTGTAGG - Intergenic
1041764143 8:61399825-61399847 GTCAAAGATCAGATGGTTGTAGG + Intronic
1041859275 8:62493314-62493336 GTCAAAAATCAGATGGTTCTAGG + Intronic
1042166815 8:65953688-65953710 TTGAAAACTTAGAAGGTAGTAGG + Intergenic
1042514043 8:69641401-69641423 GTGAATAACGAGAAGGTGCTGGG + Intronic
1042514311 8:69643882-69643904 GAGAAAAATCAACAGGTTGTTGG + Intronic
1042927284 8:73978802-73978824 CTGACAAATCAGAAGATGGAAGG + Exonic
1043488622 8:80724726-80724748 GTGAAAAATCAGAATGGAGAAGG - Intronic
1043496216 8:80803534-80803556 GTCAAAGATCAGATGGTTGTAGG - Intronic
1043805240 8:84664106-84664128 GTCAAAGATCAGATGGTTGTAGG + Intronic
1043845499 8:85158626-85158648 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1043923416 8:86009859-86009881 GTCAAAGATCAGATAGTGGTAGG + Intronic
1044200492 8:89429526-89429548 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1044502062 8:92969091-92969113 GTCAAAGATCAGATGGTTGTAGG + Intronic
1044550937 8:93511690-93511712 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1044614221 8:94122637-94122659 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1044802667 8:95973257-95973279 GTGGAAGATCAGATGGTTGTAGG - Intergenic
1045164495 8:99588112-99588134 GTCAAAGATCAGATGGTTGTAGG + Intronic
1045177723 8:99743676-99743698 GTCAAAGATCAGATGGTTGTAGG - Intronic
1045731036 8:105241075-105241097 GTGAAAAGACAGAAGATGGAAGG - Intronic
1045909131 8:107384910-107384932 GTCAAAGATCAGATGGTTGTAGG + Intronic
1046028062 8:108748885-108748907 GTCAAAGATCAGATGGTTGTAGG + Intronic
1046145356 8:110151170-110151192 GTCAAATATCAGATGGTTGTAGG + Intergenic
1046697707 8:117360514-117360536 ATGAAAAATCAGAAGAGGCTGGG + Intergenic
1047211244 8:122842190-122842212 TTGGAAAATGAGAAGGTTGTAGG + Intronic
1048525466 8:135198352-135198374 ATGAAAAATCAGAGGGAGGGAGG + Intergenic
1048640826 8:136358831-136358853 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1048780961 8:138000553-138000575 GTTGAAAATCAGATGGTTGTAGG + Intergenic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1050177941 9:2888651-2888673 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1050249033 9:3724313-3724335 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1050404011 9:5288225-5288247 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1050411194 9:5367440-5367462 GTTAAAGATCAGATGGTTGTAGG - Intronic
1050617042 9:7412361-7412383 GTGAAAGATCAGATGGCTGTAGG - Intergenic
1050617916 9:7421815-7421837 GTGAAAGATCAGATGATTGTAGG + Intergenic
1050986248 9:12086885-12086907 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1051234714 9:14987162-14987184 AGAAAAAATTAGAAGGTGGTTGG - Intergenic
1051259932 9:15253294-15253316 ACAAAAAAACAGAAGGTGGTGGG + Intronic
1051300849 9:15649098-15649120 GTCAAAGATCAGATGGTTGTAGG - Intronic
1051603756 9:18899640-18899662 GTCAAAGATCAGATGGTTGTAGG - Intronic
1052005661 9:23345467-23345489 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1052242333 9:26289223-26289245 GTGAAAGATCAGATGGTTGTAGG + Intergenic
1052701977 9:31948987-31949009 GTCAAAGATCAGACGGTTGTAGG - Intergenic
1052707894 9:32015490-32015512 GTAAAAGATCAGATGGTTGTAGG + Intergenic
1052792921 9:32893700-32893722 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1052793164 9:32896765-32896787 GTTGAAAATCAGATGGTTGTAGG + Intergenic
1053135589 9:35648632-35648654 GTTAAGAATCAGCAGGTGATGGG + Intergenic
1053222157 9:36321149-36321171 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1053490183 9:38493923-38493945 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1053535700 9:38923463-38923485 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1054207921 9:62147868-62147890 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1054630432 9:67440485-67440507 GTCAAAGATCAGATGGTGGTAGG - Intergenic
1055316045 9:75035511-75035533 GGGAAATATCAGAATTTGGTTGG + Intergenic
1055319208 9:75065627-75065649 TTTTAAAATCAGAAGGTGTTAGG + Intronic
1055442070 9:76346177-76346199 GTCAAAAATCAGATGGTTGTAGG + Intronic
1055523266 9:77104061-77104083 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1055617448 9:78087772-78087794 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1056010320 9:82322472-82322494 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1056732643 9:89178943-89178965 GTGAAAAATCAAAGGTTGGAAGG - Intergenic
1057670513 9:97083191-97083213 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1058088419 9:100776650-100776672 GGGATTAATCAGAAGGTGATAGG + Intergenic
1058199649 9:102023529-102023551 GTGGAAAATCAGATGATTGTAGG + Intergenic
1058293493 9:103275225-103275247 GTCAAAAATAAGATGGTTGTAGG - Intergenic
1058441393 9:105011190-105011212 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1059017489 9:110535307-110535329 GTCAAAGATCAGATGGTTGTAGG + Intronic
1059226067 9:112674386-112674408 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1059594795 9:115708078-115708100 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1059913123 9:119068353-119068375 GTTAAAAATCAGATGGTCGTAGG + Intergenic
1059995113 9:119901411-119901433 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1060699758 9:125740484-125740506 GATAAAAATTAGAAGGTGGTGGG + Intergenic
1062298160 9:135846231-135846253 GTCAAAGATCAGATGGTTGTAGG - Intronic
1203660675 Un_KI270753v1:39177-39199 GTGAAAAATGACAAACTGGTAGG - Intergenic
1185914407 X:4019335-4019357 GTGGAGAATAAGAAGCTGGTGGG + Intergenic
1186605720 X:11088701-11088723 GTCAAAGATCAGATGGTAGTAGG - Intergenic
1187286463 X:17909139-17909161 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1187637310 X:21244092-21244114 GTCAAAAATGAGGTGGTGGTAGG + Intergenic
1187640905 X:21288376-21288398 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1187818607 X:23260752-23260774 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1187918945 X:24182413-24182435 TTGAAAAATCAGGAGGTTTTGGG + Intronic
1187945383 X:24421549-24421571 GTGGAAGATCAGATGGTTGTAGG + Intergenic
1187999818 X:24970157-24970179 GTCAAACATCAGATGGTTGTAGG - Intronic
1188204155 X:27331716-27331738 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1188227916 X:27624705-27624727 GTCAAAGATCAGATGGTTGTAGG - Intronic
1188631957 X:32374594-32374616 GTCAAAAATCAGTTGGTTGTAGG + Intronic
1188713088 X:33426082-33426104 GTTAAAAATCAGATAGTTGTAGG + Intergenic
1188717746 X:33481288-33481310 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1189049042 X:37624804-37624826 CTGAAACATCAGCAGTTGGTTGG + Intronic
1189582467 X:42421596-42421618 GTCAAAGATCAGACGGTTGTAGG - Intergenic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1189766330 X:44375983-44376005 GTGAAAGATCAGATGGTTGTAGG + Intergenic
1189894341 X:45638553-45638575 GTCAAAGATCAGTTGGTGGTAGG - Intergenic
1190364686 X:49680517-49680539 CTGAAAAGTCAGAGGGTAGTGGG + Intergenic
1190536517 X:51433594-51433616 GAGAAAAATCAGCAGGAGGGGGG - Intergenic
1190605009 X:52132240-52132262 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1191018650 X:55837375-55837397 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1191023023 X:55883151-55883173 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1191042254 X:56095790-56095812 GTAAAAAATCAGCAAATGGTGGG + Intergenic
1191598922 X:62981089-62981111 GTCAAAGATCAGATGGTCGTAGG + Intergenic
1191630880 X:63320749-63320771 GTGAAAGATCAGATAGTTGTAGG - Intergenic
1191746013 X:64487726-64487748 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1191867325 X:65715110-65715132 GTCAAAGATCAGATGGTTGTAGG + Intronic
1191888360 X:65913641-65913663 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1192248648 X:69392970-69392992 GGGAAAGACCAGAAGTTGGTGGG - Intergenic
1192277076 X:69643898-69643920 GTTGAAAATCAGATGGTTGTAGG + Intronic
1192702463 X:73489821-73489843 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1192710141 X:73573234-73573256 GTCAAAGATCAGATGGTAGTAGG + Intronic
1192948480 X:75990739-75990761 GTGAAAAAGCTGAAGGGGGCAGG + Intergenic
1193011818 X:76684627-76684649 GTGAAACATCAGTTGGTTGTAGG + Intergenic
1193073126 X:77327689-77327711 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1193093016 X:77514457-77514479 GTCAAAGATCAGATGGTTGTAGG - Intronic
1193168745 X:78312180-78312202 GTCAAAGATCAGATGGTTGTAGG - Intronic
1193207668 X:78767607-78767629 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1193385292 X:80863699-80863721 GTGAAGGATCAGATGGTTGTAGG + Intergenic
1193389648 X:80911555-80911577 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1193409757 X:81148331-81148353 GTCAAAGATCAGATGGTTGTAGG - Intronic
1193496053 X:82214386-82214408 GGGAAAGATCAGATGGTTGTAGG + Intergenic
1193607768 X:83589189-83589211 GTCAAAAATCAGATGGTTGTAGG - Intergenic
1193674420 X:84432125-84432147 GTCAAAGATCAGATGGTTGTAGG + Intronic
1193893303 X:87079102-87079124 GTGAAAGATCAGATAGTTGTAGG + Intergenic
1193942224 X:87689956-87689978 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1193984569 X:88224499-88224521 GTCAAAGATCAGATGGTTGTTGG + Intergenic
1194072607 X:89345805-89345827 GTTAAAAATTAGATGGTTGTAGG + Intergenic
1194216967 X:91142488-91142510 GTGAAAGATCAGATGGTTATAGG - Intergenic
1194274270 X:91859753-91859775 GTCAAAGATCAGATGGTTGTAGG + Intronic
1194322763 X:92472402-92472424 GTCAAAAATCAGAGAGTTGTAGG + Intronic
1194337965 X:92672441-92672463 GTTAAAAATCAGATGGTTGTAGG - Intergenic
1194359609 X:92933469-92933491 GTCAAACATCAGATGGTTGTAGG - Intergenic
1194805405 X:98320824-98320846 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1194830226 X:98614566-98614588 GTAAAAAATCAGATAGTTGTAGG + Intergenic
1194984274 X:100473318-100473340 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1195104294 X:101588574-101588596 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1195209164 X:102635231-102635253 GTCAAAAATCAGATGGTCGTAGG - Intergenic
1195241213 X:102954036-102954058 GTTAAGGATCAGATGGTGGTAGG + Intergenic
1195344458 X:103935628-103935650 GTCAAAGATCAGATGGTTGTAGG + Intronic
1195807684 X:108794288-108794310 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1196040578 X:111198616-111198638 GTCAAAAATCAGGTGGTTGTGGG + Intronic
1196052181 X:111317276-111317298 GTCAAAGATCAGATGGTTGTAGG - Intronic
1196132295 X:112170049-112170071 GTTGAAGATCAGAAGGTTGTAGG + Intergenic
1196219808 X:113099745-113099767 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1196225434 X:113160206-113160228 GTAAAAAATCAGATGGTTGTAGG + Intergenic
1196233940 X:113257183-113257205 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1196238520 X:113311487-113311509 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1196244669 X:113386693-113386715 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1196332409 X:114487604-114487626 GTGGAAGATCAGATGGTTGTAGG + Intergenic
1196481458 X:116155023-116155045 GTGAAAAAGCAGAATATGGGTGG + Intergenic
1196484840 X:116194266-116194288 GTCAAAGATCAGAGGGTTGTAGG - Intergenic
1196550069 X:117013986-117014008 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1196926477 X:120638464-120638486 GTCAAAAATCAGATGGCTGTAGG - Intergenic
1197089259 X:122517442-122517464 GTCAAAAATCAGATGGTTGCAGG - Intergenic
1197183944 X:123565471-123565493 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1197402748 X:126011797-126011819 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1197553312 X:127921932-127921954 GTCAAAAATCAGCTGGTTGTAGG - Intergenic
1197642540 X:128982885-128982907 GTTAAAGATCAGATGGTTGTAGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1197967705 X:132082619-132082641 GTGGAAAATCAGAAGCTGCATGG - Intronic
1198245885 X:134831466-134831488 GTGAAAGTTCAGAAGGTAATGGG - Intronic
1198650027 X:138852405-138852427 GTCAAAGATCAGATGGTTGTAGG - Intronic
1198687498 X:139242872-139242894 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1198879380 X:141262895-141262917 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1198885274 X:141328534-141328556 GTCAAAGATCAGATAGTGGTAGG - Intergenic
1198922336 X:141744243-141744265 GTCAAAGATCAGACGGTTGTAGG - Intergenic
1199269673 X:145868293-145868315 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1199466072 X:148138843-148138865 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1199946734 X:152675775-152675797 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1199994940 X:153017447-153017469 GTCAAAGATCAGATGGTTGTCGG - Intergenic
1200321133 X:155190959-155190981 GTAAAAGATCAGATGGTTGTAGG + Intergenic
1200330154 X:155287244-155287266 GTCAAAAATCACATGGTTGTAGG + Intronic
1200474146 Y:3623774-3623796 GTTAAAAATCAGTTGGTTGTAGG + Intergenic
1200591507 Y:5081160-5081182 GTCAAAGATCAGATGGTTGTAGG + Intronic
1200630918 Y:5585880-5585902 GTCAAAAATCAGAGAGTTGTAGG + Intronic
1200646373 Y:5789180-5789202 GTTAAAAATCAGATGGTTGTAGG - Intergenic
1200667804 Y:6049292-6049314 GTCAAACATCAGATGGTTGTAGG - Intergenic
1200726846 Y:6681554-6681576 GTTAAAAATTAGATGGTTGTAGG + Intergenic
1200727998 Y:6697330-6697352 GTTAAAAATTAGATGGTTGTAGG + Intergenic
1201399419 Y:13588075-13588097 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1201496247 Y:14593761-14593783 GTGAAAAAACACAAAGAGGTGGG - Intronic
1201731245 Y:17206045-17206067 GTGGAATATTAGAGGGTGGTGGG - Intergenic
1201964117 Y:19713020-19713042 GTCAAAGATCAGATGGTTGTAGG - Intronic
1202300682 Y:23410537-23410559 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1202332987 Y:23774272-23774294 GTCAAAGATCAGATGGTTGTGGG + Intergenic
1202340863 Y:23865364-23865386 CTCAGAAGTCAGAAGGTGGTGGG - Intergenic
1202529903 Y:25804722-25804744 CTCAGAAGTCAGAAGGTGGTGGG + Intergenic
1202537782 Y:25895791-25895813 GTCAAAGATCAGATGGTTGTGGG - Intergenic
1202570129 Y:26260061-26260083 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1202593314 Y:26510263-26510285 GTGAAAAGTGAGGAGGTGATTGG + Intergenic
1202593673 Y:26513682-26513704 GTGAAAAGTGAGGAGGTGATTGG + Intergenic