ID: 1060680797

View in Genome Browser
Species Human (GRCh38)
Location 9:125562291-125562313
Sequence CACTTCATATTTAAGAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060680797_1060680800 20 Left 1060680797 9:125562291-125562313 CCCCAGTTCTTAAATATGAAGTG 0: 1
1: 0
2: 0
3: 14
4: 248
Right 1060680800 9:125562334-125562356 ACATTTGTAAAGTGCCCCCCTGG No data
1060680797_1060680802 27 Left 1060680797 9:125562291-125562313 CCCCAGTTCTTAAATATGAAGTG 0: 1
1: 0
2: 0
3: 14
4: 248
Right 1060680802 9:125562341-125562363 TAAAGTGCCCCCCTGGGCTGTGG No data
1060680797_1060680801 21 Left 1060680797 9:125562291-125562313 CCCCAGTTCTTAAATATGAAGTG 0: 1
1: 0
2: 0
3: 14
4: 248
Right 1060680801 9:125562335-125562357 CATTTGTAAAGTGCCCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060680797 Original CRISPR CACTTCATATTTAAGAACTG GGG (reversed) Intronic
902970611 1:20045414-20045436 CCCTTCATGTTTAATCACTGTGG - Intronic
903426848 1:23259964-23259986 CACTTCTTACTGAAGGACTGTGG + Intergenic
909235299 1:73145564-73145586 CACTTCAAATTTAGGTAATGTGG + Intergenic
909314580 1:74199316-74199338 CTCTTCTTATTGAAGAATTGAGG + Intronic
911229313 1:95343877-95343899 CACATAATATTTAAGATTTGAGG - Intergenic
912257260 1:108073014-108073036 CACTTGACATCTTAGAACTGAGG - Intergenic
915096634 1:153467151-153467173 CAGAAAATATTTAAGAACTGGGG + Intergenic
915829426 1:159112809-159112831 AACTCCATATTCAAGAAATGTGG - Intronic
915899628 1:159836970-159836992 CACATCATTTTTAGGGACTGAGG - Exonic
916261635 1:162848136-162848158 CACTTCATACCTTTGAACTGGGG + Intronic
917190342 1:172410855-172410877 CATTTCATATTTGAGAATTATGG - Exonic
917414748 1:174797327-174797349 CATTTCACATTTAAGAACAAGGG - Intronic
919172997 1:193979906-193979928 CATATCATATTTAATAAATGTGG - Intergenic
919486079 1:198148691-198148713 CACTTCATCTTTTGGAAATGTGG + Intergenic
919597290 1:199579752-199579774 CACTTCATTTATAAGATGTGAGG - Intergenic
919948472 1:202340562-202340584 TACTTTATATTTAAGAGATGGGG - Intronic
921815759 1:219561510-219561532 CATTTCATACTAAAGAACTGGGG + Intergenic
923878696 1:238078991-238079013 CACATCATACTTAACAACAGAGG - Intergenic
924078158 1:240363027-240363049 GACTGTATATTTAAGAGCTGAGG - Intronic
924293099 1:242558284-242558306 CACTTTATATTTAAAAACACAGG + Intergenic
924387106 1:243509147-243509169 CACATGTTATTTAAGAACAGAGG + Intronic
1063175530 10:3547651-3547673 GACTTCAAATTTAAGAAATTTGG - Intergenic
1063674424 10:8127409-8127431 CACAACATATTCAAGAAATGAGG - Intergenic
1063681041 10:8188315-8188337 CACTTCACAATTAAGAACCTGGG + Intergenic
1064835079 10:19517569-19517591 GATTTCATATATAAGAACTATGG - Intronic
1065281231 10:24140681-24140703 CATTTAATATTTTTGAACTGAGG + Intronic
1065686400 10:28289496-28289518 CACTTAAATCTTAAGAACTGGGG + Intronic
1066048592 10:31615899-31615921 TGCTTCCTGTTTAAGAACTGGGG + Intergenic
1069485826 10:68822483-68822505 CACACCATCTTTAAGAACTTTGG - Intergenic
1070468511 10:76750810-76750832 AACATAATATTCAAGAACTGTGG + Intergenic
1070527842 10:77310489-77310511 CTCTTCAGATTAAGGAACTGAGG + Intronic
1071087546 10:81880280-81880302 CACTTCAGTCTGAAGAACTGGGG - Intronic
1073211426 10:101806084-101806106 GTCTCCATATTTAAGGACTGTGG - Exonic
1073937837 10:108655452-108655474 AACTTCATTTTGAAGAACTAAGG - Intergenic
1075140115 10:119825702-119825724 TATTTCATATTTAAAAAGTGTGG + Intronic
1075385749 10:122054152-122054174 CTCTTCCTATTGAAGAACTTTGG - Intronic
1077476822 11:2794409-2794431 CACTTGATCTCTAAGCACTGGGG - Intronic
1077619503 11:3707798-3707820 CACTTAAATTTTAAGAACAGTGG + Intronic
1078083833 11:8221975-8221997 CACTTCATAGTGCAGATCTGGGG + Intergenic
1078364714 11:10697016-10697038 CAGTTCCTTTTTTAGAACTGTGG - Intergenic
1078769676 11:14337149-14337171 CATTTAATATTTTTGAACTGTGG - Intronic
1079662538 11:23058140-23058162 CACTTCATTTTTTATAATTGGGG - Intergenic
1079982253 11:27163725-27163747 CTCTTCATGGTTAAGAACTTAGG - Intergenic
1080914329 11:36639974-36639996 CAACAAATATTTAAGAACTGTGG + Intronic
1081161137 11:39750122-39750144 AACTTCATTTTGAAGAAATGTGG + Intergenic
1081311433 11:41578722-41578744 CATTTAATATTTTTGAACTGTGG - Intergenic
1081343296 11:41953626-41953648 CACTTCAGGTAGAAGAACTGAGG - Intergenic
1083449475 11:62733112-62733134 CACTCCCTATTTCACAACTGTGG - Intronic
1085695313 11:78699403-78699425 TACTTCATATGTAAAAAATGTGG + Intronic
1085788738 11:79477389-79477411 CTGCCCATATTTAAGAACTGGGG - Intergenic
1086927462 11:92655912-92655934 CATTGCATATTTATGAAATGAGG - Intronic
1086933345 11:92717809-92717831 CTCTTCTTTTTTAAGAAGTGAGG - Intronic
1087938554 11:104064518-104064540 CAAATCATATTTCATAACTGGGG + Intronic
1088393556 11:109342553-109342575 CAGTCCATATTTAAGAAGCGAGG + Intergenic
1088416538 11:109595490-109595512 CATTTCATATTTAAAAGTTGTGG + Intergenic
1088811368 11:113395053-113395075 CACATCATATTTAGGTCCTGGGG - Exonic
1092550276 12:9491156-9491178 CACTTAATGTTTATGCACTGGGG + Intergenic
1095210948 12:39494000-39494022 AAATACATATTTAACAACTGAGG - Intergenic
1096988742 12:55780904-55780926 CATTTAATATTTTAGGACTGTGG + Intronic
1098222182 12:68281938-68281960 CACTTCATAGTTACACACTGAGG + Intronic
1098779891 12:74673603-74673625 CACTTCATTTTTAAAACATGGGG - Intergenic
1099445412 12:82745902-82745924 GACTTCAGAATTAGGAACTGTGG + Intronic
1099529555 12:83761199-83761221 AACTTCATGTTTAAGAACATAGG + Intergenic
1099732002 12:86516785-86516807 CACTTCATATATGAGAAATAAGG - Intronic
1100070535 12:90710929-90710951 CACTTCATGATTTAGAACTGTGG - Intergenic
1100415305 12:94366454-94366476 AACTTTATATTTTAGGACTGAGG + Intronic
1100893650 12:99155043-99155065 CAATTCAGATTTAAGCACTTTGG - Intronic
1103157996 12:118703412-118703434 ACCTTCATATCTAGGAACTGGGG + Intergenic
1103219977 12:119235893-119235915 CACGGCACATTTGAGAACTGTGG - Intergenic
1109045034 13:57399879-57399901 CATTTCTTATTATAGAACTGGGG + Intergenic
1110205085 13:72902506-72902528 TACTTAATATTTAAAAGCTGAGG - Intronic
1111144484 13:84163126-84163148 CACTTCAGATTTTAGGACTTGGG - Intergenic
1112072902 13:95874588-95874610 CACTTAATATTTTTGGACTGTGG + Intronic
1112577568 13:100649801-100649823 TACTTAATATTTAAAAACTATGG + Intronic
1113211911 13:107993293-107993315 CAAATTATATTTAGGAACTGAGG - Intergenic
1113339385 13:109407386-109407408 CACTTAATATTAATGATCTGTGG - Intergenic
1115032965 14:28820014-28820036 CAGTTCACACTTAAGGACTGAGG - Intergenic
1115713403 14:36075135-36075157 CATTTCATATTTTAGATCTTAGG - Intergenic
1116043811 14:39718279-39718301 AAATTGATATGTAAGAACTGTGG + Intergenic
1116307469 14:43276446-43276468 CTTTTCATGTTTCAGAACTGAGG - Intergenic
1116507262 14:45699473-45699495 GACTTCATATTAATGAATTGTGG - Intergenic
1116739942 14:48741642-48741664 CACTTCAAAGTTAAACACTGTGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117980282 14:61336141-61336163 CACTTCATATTGAAGTGCTGAGG - Intronic
1119151548 14:72364602-72364624 CAATTTTTATTAAAGAACTGGGG - Intronic
1121081706 14:91114001-91114023 CTCTGCAGCTTTAAGAACTGGGG + Intronic
1124168191 15:27348053-27348075 CAGTTAATGTTTAAGAGCTGGGG + Intronic
1126317733 15:47388352-47388374 CATTTCATATTTTTGGACTGTGG - Intronic
1127992558 15:64131569-64131591 CACTGCATATCTGGGAACTGAGG - Intronic
1128169562 15:65499185-65499207 CACTTCCTGTGTAAGCACTGAGG - Intronic
1129751320 15:78066587-78066609 CACACAAAATTTAAGAACTGCGG + Intronic
1131966947 15:97854447-97854469 CACTTCATAGCAAAGAAGTGTGG + Intergenic
1132485925 16:190946-190968 GACTCCAAATTTAAGAAGTGAGG + Intronic
1133967575 16:10542644-10542666 CACTTCATAATGAAAAACAGTGG + Intronic
1135055059 16:19224972-19224994 CACTTAACATCTATGAACTGGGG + Intronic
1138071395 16:53996351-53996373 AACATCATATTTAAGAAATTTGG + Intronic
1141769264 16:86079260-86079282 CACTTCAAGTTCATGAACTGAGG + Intergenic
1145356522 17:22160331-22160353 CATTTTATATTAAAGCACTGTGG - Intergenic
1149874694 17:60220314-60220336 CTCTTCATATTAACGAAATGTGG - Intronic
1150987006 17:70209595-70209617 CACTTCATAGTTAAGCACCTTGG + Intergenic
1151628852 17:75296160-75296182 CAGATTATATTTTAGAACTGTGG - Intergenic
1152050938 17:77976626-77976648 CACTTCATATATAAAACTTGGGG + Intergenic
1154112917 18:11585747-11585769 CACTTCATGATTAAGATCTTAGG + Intergenic
1154468120 18:14669569-14669591 CACTTGCTATTTAGGAACTTAGG + Intergenic
1155549917 18:26954026-26954048 AATTTCATATTCCAGAACTGTGG + Intronic
1155641482 18:28021694-28021716 CATTTAATATATAAGATCTGTGG - Intronic
1155785172 18:29887886-29887908 CAATTCAATTTTAAGAACAGAGG - Intergenic
1155909491 18:31492133-31492155 CACTCCTGATTTAAGAAGTGAGG - Intergenic
1156128076 18:33932589-33932611 CACTTAATATTTAAAAAATGAGG + Intronic
1157380279 18:47208280-47208302 CATTTCATACTTAGAAACTGAGG - Intergenic
1157991479 18:52501957-52501979 CCCTTCTCATTTACGAACTGTGG - Intronic
1158116594 18:54003237-54003259 CAGTTTATATTGAACAACTGCGG - Intergenic
1160614123 18:80110767-80110789 CACTTCATGTTTAAGGACGACGG - Intronic
1162303797 19:9859253-9859275 CACTTAATATTTTTGGACTGTGG - Intronic
1164695515 19:30240754-30240776 CAACTAATATTTAAGGACTGAGG - Intronic
927380504 2:22474702-22474724 CTCTTCATATGTAATATCTGTGG + Intergenic
928402581 2:30990003-30990025 CATTTCATTTTTGAGAACTTAGG + Intronic
928799947 2:35076889-35076911 TACTTCATCTGTAAGAATTGGGG - Intergenic
928916556 2:36477987-36478009 GACTTCAGATTGAAGATCTGGGG - Intronic
930512890 2:52368181-52368203 CATTCCAAATGTAAGAACTGAGG - Intergenic
930889693 2:56369620-56369642 CACTTCATACTTTATTACTGAGG + Intronic
931191185 2:60001948-60001970 CAATTCATATTTCAGTACTTTGG + Intergenic
931425478 2:62167352-62167374 CAACTCATATTTAAGAAGTAGGG - Intergenic
931613542 2:64130623-64130645 CACTTAATATTGAAGAAATAAGG + Intronic
931687259 2:64805080-64805102 TACTTCATATTTAGCAACTATGG - Intergenic
934938017 2:98479217-98479239 CACTTCTAATTTTAGAAGTGTGG + Intronic
935704648 2:105845350-105845372 GAATTCATTTGTAAGAACTGAGG + Intronic
938739522 2:134218218-134218240 AACACCATGTTTAAGAACTGTGG + Intronic
938930995 2:136086905-136086927 CACTACACATTTCAGAACTAAGG + Intergenic
939481641 2:142755509-142755531 GACTACATATTTTAGAACAGTGG - Intergenic
943010806 2:182446527-182446549 AATGTCAGATTTAAGAACTGAGG + Intronic
943595854 2:189855077-189855099 CACTACAAATTGAAGAACTGTGG + Exonic
945750860 2:213780636-213780658 GACTTTGGATTTAAGAACTGAGG + Intronic
947325393 2:228969073-228969095 TACTTCATCTTTAATAACTGAGG + Intronic
1170721304 20:18881800-18881822 AACAGCATATTCAAGAACTGTGG - Intergenic
1173069606 20:39750191-39750213 CCCTGAATATTTAAGAACTCAGG - Intergenic
1173327902 20:42050358-42050380 ATTTTCAGATTTAAGAACTGAGG + Intergenic
1175452722 20:59083795-59083817 CACTTGGTATCTAGGAACTGGGG + Intergenic
1176806396 21:13488080-13488102 CACTTGCTATTTAGGAACTTAGG - Intergenic
1177246146 21:18526904-18526926 CAATCCATATTTAAGGAGTGGGG + Intergenic
1177291933 21:19123938-19123960 CATTTAATATTTTTGAACTGAGG + Intergenic
1177424164 21:20901137-20901159 CATTTCATATTTCAAAGCTGAGG + Intergenic
1179455694 21:41498353-41498375 CCCTCCATATTTAAGGACTTTGG + Intronic
1180287515 22:10762833-10762855 CACTTCTTTTTTAAGAAAAGTGG - Intergenic
1182582022 22:31319721-31319743 CACTTCATAGGTAAGAAATGAGG - Intergenic
953017754 3:39094684-39094706 CACTTCATATGGAAGAGCGGTGG + Exonic
953241906 3:41157022-41157044 CTCTTCATATATAAGACTTGAGG + Intergenic
953588134 3:44223665-44223687 AAGTTCATGTTTGAGAACTGTGG - Intergenic
953901815 3:46847810-46847832 CACTTTATTTTTAAGAAGTCTGG - Intergenic
955994112 3:64660459-64660481 CATTTAATATTTAAGGACTGAGG - Intronic
956696969 3:71926771-71926793 CACTTCAGGTCTAAGAATTGTGG - Intergenic
957443046 3:80277496-80277518 CACTCCATATTTATGAATTAAGG - Intergenic
958159271 3:89795911-89795933 CACTTTCTATTTAAAAACTCTGG + Intergenic
958426240 3:93980965-93980987 CATTTAATATTTAAGAAAGGTGG - Intronic
958700530 3:97583104-97583126 TATTTAATATTTATGAACTGTGG - Intronic
960482067 3:118204010-118204032 CAGTTCACATTTTAGAAGTGGGG + Intergenic
960647193 3:119899289-119899311 CACTTAATGTTTCTGAACTGTGG + Intronic
960653079 3:119973235-119973257 CATTTAATATTTTGGAACTGTGG - Intronic
960913150 3:122669225-122669247 CACTTCATTTTTTAGAGATGGGG + Intergenic
961342102 3:126232810-126232832 CACTACATATTTGATAACTTAGG - Intergenic
961431369 3:126886279-126886301 CACTTAATATTTTTGGACTGAGG - Intronic
961831724 3:129626613-129626635 GACTTCACATTTGAGATCTGAGG + Intergenic
962517666 3:136168773-136168795 AACTTAATATTTAAAAACTTTGG - Intronic
963466964 3:145694534-145694556 CACTTCATATAGGAAAACTGTGG + Intergenic
963948659 3:151174094-151174116 CACTTCAGATTTTCAAACTGGGG - Intronic
964644835 3:158947772-158947794 CACATCATTTTTAAGCACAGAGG + Intergenic
965090998 3:164162828-164162850 CACTTCATATATGAGAGCTCTGG - Intergenic
965123766 3:164596684-164596706 CACTTCATATATCAAAACAGTGG - Intergenic
965203238 3:165687888-165687910 AACTGAATATTTAACAACTGTGG + Intergenic
965320363 3:167246054-167246076 TTCTTCATATTCAATAACTGAGG - Intronic
966834850 3:184041376-184041398 CTCTTTAGATTTTAGAACTGTGG + Intergenic
967809215 3:193742547-193742569 GACTTCATATATATGAACTATGG - Intergenic
969999989 4:11355352-11355374 GAGTTCACATTTAAGGACTGAGG - Intergenic
970118415 4:12725419-12725441 CACATCAAATTAGAGAACTGAGG - Intergenic
972184996 4:36517956-36517978 CACTTCCTAGTTAAGAAATTTGG + Intergenic
974399486 4:61385144-61385166 AACTTCATATTTGGGACCTGTGG + Intronic
974666933 4:64974192-64974214 CTATTCATACTTAAGAAATGGGG - Intergenic
975170811 4:71230119-71230141 CAAATCATGTTTAAGAAGTGGGG - Intronic
976913999 4:90347468-90347490 CATTTCATATTTTTGGACTGTGG - Intronic
977165959 4:93697381-93697403 CACATCAAGTTTAAGAACTCAGG + Intronic
977366633 4:96077406-96077428 CAATTCATATTTGAAAACTATGG + Intergenic
979228061 4:118313121-118313143 CACTTCATATTCAAGGCCAGTGG + Intronic
981766868 4:148261135-148261157 CACTTCATAAAGTAGAACTGGGG + Intronic
982640141 4:157948515-157948537 CCCAACATATTTAAAAACTGTGG - Intergenic
984273695 4:177581187-177581209 CAGTTTATAATTAGGAACTGAGG + Intergenic
984434759 4:179695442-179695464 CAGTTTATATTTTTGAACTGTGG + Intergenic
984978652 4:185255822-185255844 CACTTACTATGTAGGAACTGTGG + Intronic
986576973 5:9222386-9222408 CACTTCATATGCAATAACTCAGG + Intronic
986960490 5:13204627-13204649 GACTTCACAATTAAGAACTTTGG + Intergenic
986970024 5:13322568-13322590 CACTTCATTTGAAAGAACTTCGG - Intergenic
987589295 5:19902787-19902809 CATTTTATATTTCAGAACTTTGG + Intronic
987921846 5:24293781-24293803 TACTTCATATTTAAGATTTTTGG + Intergenic
989536838 5:42573721-42573743 GACTTGATATTTAAGGAATGGGG - Intronic
992752010 5:79870581-79870603 CCCTTCATCTTTAAGTCCTGGGG - Intergenic
994993440 5:107028774-107028796 CACTTCATATCTAAAATCAGGGG + Intergenic
995888777 5:116925830-116925852 CACATCATATTTTAGAGCAGGGG + Intergenic
996292823 5:121874237-121874259 CACATTATATTTAACATCTGTGG + Intergenic
997025842 5:130059958-130059980 CACTTCATTTTTTAAAAGTGTGG - Intronic
998597374 5:143546967-143546989 TAGTTCATCTTAAAGAACTGAGG + Intergenic
999746100 5:154593182-154593204 CACATAATATTTTTGAACTGTGG - Intergenic
1003613953 6:7638072-7638094 CATTTAATATTTAAAAACTGCGG + Intergenic
1005272999 6:24186504-24186526 CACTTCTTATTGAAGAACAGTGG + Intronic
1006675106 6:35756990-35757012 CAGGACATATTTAAGAAGTGGGG - Intergenic
1007902975 6:45429117-45429139 CAATTCATATTGGAAAACTGTGG + Intronic
1009417936 6:63436493-63436515 CACTTCATTTGCAAGTACTGTGG + Intergenic
1009536492 6:64894888-64894910 CACTGTATATTCAAGAATTGTGG - Intronic
1009569735 6:65369027-65369049 CACTTCATTTTTAAGAAAACGGG - Intronic
1011947631 6:92926348-92926370 GACTTCATATTTTAAAATTGAGG + Intergenic
1013006151 6:106075727-106075749 CTCTTCTTTTTTAAGAGCTGGGG + Intergenic
1014394189 6:120904163-120904185 CACTTCGTATTTTATAAATGAGG - Intergenic
1014641633 6:123917957-123917979 AATTTCATATTTAACAACGGTGG - Intronic
1014771465 6:125462471-125462493 AACAGAATATTTAAGAACTGTGG - Intergenic
1015076465 6:129164361-129164383 CATTTAATATTTTCGAACTGTGG + Intronic
1015916359 6:138221285-138221307 CACCTCATATTTAAAAGGTGGGG + Intronic
1015970759 6:138740851-138740873 AACTTCACATATGAGAACTGGGG - Intergenic
1016141927 6:140623520-140623542 CACTTAATATTTTTGGACTGTGG - Intergenic
1016459426 6:144266456-144266478 CACGTCATCTTTAAGAATTATGG - Intergenic
1017274337 6:152548490-152548512 CACTGCATGTTGAAGAAGTGGGG + Intronic
1017686421 6:156917721-156917743 CATTTCATTTTTAATCACTGAGG - Intronic
1017809231 6:157972989-157973011 GACTTCACATTTCAGAAGTGGGG + Intergenic
1021743521 7:23713035-23713057 GACTATATATTTAAGAACTCTGG - Intronic
1022036766 7:26542179-26542201 CACATCATATTTATGTAATGTGG - Intergenic
1024138760 7:46439839-46439861 AAATTCATATTTAACAACTGAGG - Intergenic
1026981595 7:74529901-74529923 CACTTCATCATTAAGAGGTGCGG + Exonic
1029517306 7:101033414-101033436 CACTTCATCTTCTACAACTGCGG + Exonic
1030137097 7:106264504-106264526 GATTTCAGATTTCAGAACTGGGG - Intronic
1030406447 7:109120547-109120569 CATTTCATATTTTACACCTGAGG - Intergenic
1031112740 7:117631381-117631403 CACTTCATAAATAGAAACTGGGG - Intronic
1031960707 7:127987157-127987179 CACTTCATATTTACAGTCTGAGG + Intronic
1032840379 7:135708539-135708561 CACATCATATTTAAATACAGTGG - Intronic
1033886414 7:145953018-145953040 CACTTTATTTTTTAGAAATGGGG - Intergenic
1034481755 7:151326576-151326598 CATTCCATCGTTAAGAACTGAGG + Intergenic
1034603230 7:152283720-152283742 CACTTCTTTTTTAAGAAAAGTGG - Intronic
1040542083 8:48368784-48368806 CAATTTATATTTAAAAACTAGGG - Intergenic
1042210887 8:66379244-66379266 CTCTTCAGAATTAATAACTGTGG - Intergenic
1042910797 8:73824098-73824120 CACTTCATTTTTAAAATTTGAGG - Intronic
1045075639 8:98563943-98563965 CAGCTCACATTTAAGAAGTGGGG - Intronic
1046508742 8:115171646-115171668 CACTCCATATTTAAGGAGTAGGG - Intergenic
1046634552 8:116659460-116659482 CTCTTCATATATAAGCAGTGTGG - Intronic
1049293036 8:141813957-141813979 CACTTCAAACTTTAGATCTGAGG + Intergenic
1049925253 9:401186-401208 CCCTTCTTATTTTAAAACTGAGG - Intronic
1050758094 9:9032966-9032988 CACTTCATATTATTGAAATGTGG + Intronic
1055235914 9:74123043-74123065 CATTTCTTATTTAAAAACTAGGG + Intergenic
1057723239 9:97549445-97549467 CAATAAATATTTAAGACCTGTGG - Intronic
1058613826 9:106804587-106804609 CACTTCTCATTTAAGAAATGGGG + Intergenic
1060680797 9:125562291-125562313 CACTTCATATTTAAGAACTGGGG - Intronic
1062679836 9:137773117-137773139 CACTTCTTATTCCAAAACTGAGG + Intronic
1187743529 X:22383391-22383413 AACTTAACATTTAAGAACTGGGG - Intergenic
1189139544 X:38587302-38587324 CAGTTCACATTTATGATCTGTGG + Intronic
1189219577 X:39359720-39359742 CACTTCATTTTTAAGGATTAGGG + Intergenic
1190521690 X:51285341-51285363 TACTTCACACTTAAGAACTGGGG + Intergenic
1192756982 X:74056676-74056698 AACTTCAACTTTAAGAATTGAGG + Intergenic
1194475229 X:94349890-94349912 CACTTCAAATTTAACAACCTGGG + Intergenic
1194813806 X:98418037-98418059 CTCTTCAGAGTTAATAACTGCGG + Intergenic
1195895338 X:109740561-109740583 AACTTGTTATTTCAGAACTGAGG + Intergenic
1196192348 X:112808290-112808312 CACTACTTATTTACCAACTGTGG - Intronic
1196646805 X:118126917-118126939 AACTTAACATTTAAAAACTGAGG + Intergenic
1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG + Intronic
1197786847 X:130207075-130207097 CACATCATATTTAAGAGCATGGG - Intronic
1198031209 X:132755047-132755069 CAGTTCATACTTAAGGAGTGAGG + Intronic
1198573843 X:137988206-137988228 ATCTTCATATTTTAGAGCTGGGG + Intergenic
1200218007 X:154377117-154377139 CACCTCATCTTTCAGAGCTGAGG - Intergenic
1202012370 Y:20357678-20357700 CGCTACATATATAAGAAATGTGG - Intergenic