ID: 1060684326

View in Genome Browser
Species Human (GRCh38)
Location 9:125594525-125594547
Sequence TTGATCAGTGACTTTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060684326 Original CRISPR TTGATCAGTGACTTTGTGGC AGG (reversed) Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901893370 1:12287258-12287280 TGGAGCAATGACTTTGTGGGGGG - Intronic
902980212 1:20117254-20117276 TTGCTCAGAGTCTTAGTGGCTGG + Intronic
903507476 1:23848191-23848213 TTGAACACTGAGTTTGTGCCTGG + Intronic
904111145 1:28127420-28127442 TTGAGCACTTACTTTGTAGCAGG + Intergenic
904647106 1:31976003-31976025 TTGAGCAGTTACTGTGTGCCAGG - Intergenic
905388306 1:37619632-37619654 TTGAGCACTTACTCTGTGGCAGG + Intronic
906545212 1:46615487-46615509 CTGAACACTGACTTTGTGCCAGG - Intronic
906964712 1:50445009-50445031 TTGAGCATTTACTTTGTGCCAGG + Intronic
908040440 1:60107107-60107129 CTGATCAGTGAGTTAGTGTCAGG + Intergenic
908081909 1:60589925-60589947 TTGACCACTGACTGTGTGCCAGG - Intergenic
908367141 1:63436509-63436531 TTGTTCAGTGCCTTGGTGGTAGG + Intronic
908842854 1:68296098-68296120 TTGAGCACTTACTATGTGGCAGG + Intergenic
909340053 1:74521389-74521411 TTGAACAGTAACTATGTGCCAGG - Intronic
911302080 1:96186740-96186762 TTGAGCACTTACTCTGTGGCAGG - Intergenic
912720964 1:112019600-112019622 TTGAGCACTTACTTTGTGCCAGG + Intergenic
913224372 1:116686049-116686071 TTGAGCAGCTACTGTGTGGCAGG + Intergenic
913615477 1:120555979-120556001 TTGATAAGTGACATTGTTGATGG - Intergenic
914574797 1:148954928-148954950 TTGATAAGTGACATTGTTGATGG + Intronic
915594738 1:156889975-156889997 TTGAGCACTTACTTTGTGCCAGG + Intergenic
915949019 1:160175424-160175446 TTGAACACTGACTATGTGGGAGG + Intronic
916008550 1:160683661-160683683 TGGATCAGGGACTGTCTGGCTGG + Intronic
916666788 1:166974480-166974502 TAGACCAGTGACTTTGATGCTGG + Intronic
917509756 1:175660385-175660407 TGGATCAGTGACCTTCTCGCAGG - Intronic
918259194 1:182779428-182779450 TTGTTCACTGACTTTCTGGTGGG + Intergenic
919347573 1:196404597-196404619 TAGATAAGTGACTTTTTAGCAGG - Intronic
921256179 1:213341614-213341636 TTGATCAGTTACTAAGTTGCAGG + Intergenic
921590065 1:216992507-216992529 TTGATCATTTACTTTATGTCAGG - Intronic
921860040 1:220033116-220033138 TTGCTCAGTGAGTGTGTGACTGG - Intronic
922091352 1:222398415-222398437 TTGATCACTGATTTTATGCCAGG - Intergenic
922623547 1:227012905-227012927 TTGAGCACTTACTTTGTGCCCGG - Intronic
924400507 1:243675495-243675517 TTAAAGAGTGACTTTGAGGCTGG - Intronic
1064042392 10:11978861-11978883 TTGATCAGTGATATTCTGGTTGG - Intronic
1065400187 10:25290650-25290672 GTGATAAATGACTTTGTGGGAGG + Intronic
1066347912 10:34607186-34607208 TTGAGTAATGACTTTGTGGGTGG - Intronic
1067184771 10:44017248-44017270 TTGAACTGTGACTATGTGCCAGG + Intergenic
1068183478 10:53553885-53553907 TTGATCACTGACTATGTGTTTGG + Intergenic
1070396592 10:76016606-76016628 TTGAACACTGACTTTATGCCAGG + Intronic
1070403530 10:76074703-76074725 TTGTTCATTGACTTTGGAGCTGG + Intronic
1070851108 10:79562175-79562197 TTAATCAGTGACTATGTTGTGGG + Intergenic
1071773262 10:88754164-88754186 TTGATCATTGACTTTGTGCCTGG - Intergenic
1071908817 10:90206403-90206425 CTGATCACTGCCTTTGTGGTTGG - Intergenic
1073411636 10:103346875-103346897 TTGAACAGTTACTGTGTGCCAGG + Intronic
1074211253 10:111337303-111337325 TTGATATGTGTCTCTGTGGCTGG + Intergenic
1074798584 10:116975628-116975650 TTTATCAGTGACTTTGAGAATGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1078946911 11:16078605-16078627 GTGGGCAGTGACTTTGTGGGAGG + Intronic
1081787638 11:45758468-45758490 ATGAGCTGTGAGTTTGTGGCAGG - Intergenic
1081847673 11:46252440-46252462 TTGATCACTGGCTCTGTGTCAGG - Intergenic
1081875043 11:46402775-46402797 TTGAGCACTTACTTTGTGTCTGG - Intronic
1085715725 11:78871526-78871548 TTGATTAGCGCCTTTGTGTCAGG + Intronic
1085785248 11:79442559-79442581 TTGACCACCTACTTTGTGGCAGG + Intergenic
1086332034 11:85763767-85763789 TTGATCAGGGCCTTTTTGTCTGG - Intronic
1089611956 11:119674132-119674154 GTGTGCAGTGGCTTTGTGGCCGG + Intronic
1089968318 11:122672107-122672129 CTGAGCAGTGACTTTGTGTCAGG + Intronic
1091686566 12:2566815-2566837 TCCAACAGTGACTTTGGGGCAGG - Intronic
1092052230 12:5480172-5480194 TTGATGAGTGAATTTGATGCTGG - Intronic
1093059232 12:14585334-14585356 ATAATAAGTGACTTTGTGACTGG - Intergenic
1094166202 12:27446520-27446542 TTGATCAGTGACGTTTTGTCAGG - Intergenic
1096178084 12:49536287-49536309 TTGAGCATTAACTTTGTGCCAGG - Intergenic
1097087734 12:56481034-56481056 TTGAACATTTACTTTGTGTCAGG - Intronic
1097900730 12:64871633-64871655 TTGTTCAGTTATTTTGTGACTGG - Intronic
1097976918 12:65696443-65696465 TTAATCATTGACTCTGTGCCAGG + Intergenic
1098063521 12:66587576-66587598 TTGAGCAGTCACTGTGTGCCAGG - Intronic
1098350670 12:69555989-69556011 TTGATCAGTGTGTGTGTGGCGGG + Intronic
1099533104 12:83811413-83811435 TTGATCATTTACTATGTGTCAGG + Intergenic
1099645837 12:85354970-85354992 TTGATCATTCATTTTGTGGCAGG + Intergenic
1101087217 12:101248721-101248743 TTGAGCACTGACTCTGTGCCAGG + Intergenic
1102094260 12:110223458-110223480 TTGAAAAATGACTTTGTAGCTGG + Intergenic
1106623606 13:31395899-31395921 TTGATCAGTTATCTTGTGCCTGG + Intergenic
1106893953 13:34277530-34277552 TTGAGCACTTACTTTGTGTCAGG + Intergenic
1107421002 13:40246316-40246338 TTGACCAGTGAACTTGTGTCTGG - Intergenic
1108544717 13:51481278-51481300 TTGATCACTTACTATGTGTCAGG - Intergenic
1109647947 13:65285117-65285139 TGGATCAGAGTCTCTGTGGCAGG - Intergenic
1110770307 13:79335398-79335420 TAGAGCACTTACTTTGTGGCAGG - Intronic
1112598745 13:100833804-100833826 GGGATCAGTGTCTTTGTGGATGG + Intergenic
1113957047 13:114104587-114104609 CTGATGAGAGGCTTTGTGGCCGG - Intronic
1115653389 14:35420006-35420028 CTGATCAGCCACTTTGTGGAGGG - Intergenic
1117438285 14:55738395-55738417 TTGAGTAGTTACTGTGTGGCAGG + Intergenic
1118432847 14:65738923-65738945 TTGAGCACGTACTTTGTGGCAGG + Intronic
1119987800 14:79159111-79159133 TTGCTCATTGACTTTATGGAGGG - Intronic
1120529379 14:85613807-85613829 TTGATCAGTGAGTAAGTGACAGG - Intronic
1121240988 14:92430057-92430079 TTGAGCAGTTACTATGTGCCAGG - Intronic
1121857442 14:97283043-97283065 ATGGTCAGGGACTTTGTGGCGGG + Intergenic
1121946901 14:98131856-98131878 ATGCTCAGTGGCTGTGTGGCTGG + Intergenic
1122065106 14:99167561-99167583 ATGCTCAGTTACTTTCTGGCTGG - Intergenic
1126075751 15:44907450-44907472 TTTATCACTTACTTTGTGACAGG + Intergenic
1126640605 15:50821640-50821662 TTGATCTGTGTCTTTGGGGTAGG + Intergenic
1127609152 15:60620527-60620549 TTGAGCAGCTACTCTGTGGCAGG - Intronic
1127880476 15:63152938-63152960 TTGATTTGTTACCTTGTGGCAGG - Exonic
1128107500 15:65055497-65055519 TTGAGCACTGACTCTGTGCCAGG - Intronic
1128344929 15:66847746-66847768 TGGGGCAGTGACTTTGGGGCAGG - Intergenic
1128369368 15:67029106-67029128 TTGATCACTTATTATGTGGCAGG + Intergenic
1129663426 15:77565978-77566000 TTGAGCAACGACTTTGTGCCAGG + Intergenic
1131634851 15:94221352-94221374 TTGCTCAGTGACTTTATGCTTGG + Intergenic
1132896270 16:2230753-2230775 TTGATGAGTGTCTTGGTCGCAGG - Intronic
1133880842 16:9780045-9780067 TTCATCAGTGGCTGTGTGGTTGG - Intronic
1134340830 16:13344216-13344238 TTACTCACTGACTTTGTGGAGGG + Intergenic
1138146763 16:54619583-54619605 TTGAACATTTACTATGTGGCAGG + Intergenic
1139430583 16:66909047-66909069 TTGCACATTGACTGTGTGGCAGG - Intronic
1139947428 16:70650771-70650793 TTGAGCAGAGACTCTGGGGCAGG + Intronic
1141026912 16:80557286-80557308 TTGATCATTTACTATGTGACAGG + Intergenic
1143307111 17:5956192-5956214 TTGATCATTTACTTTGTTCCAGG - Intronic
1143463087 17:7116325-7116347 TTGAGCAGCTACTGTGTGGCAGG - Intergenic
1144194581 17:12877846-12877868 TTGTTCAGTGACTTCTTGGATGG + Intronic
1144764712 17:17726082-17726104 TTGTTCAGGGACCTTGTGGGAGG + Intronic
1145304336 17:21664750-21664772 TTGAGCAGTTACTATGTGCCAGG + Intergenic
1146089994 17:29867397-29867419 TTGTTAAGTGTTTTTGTGGCAGG - Intronic
1146282526 17:31554036-31554058 CTGAGGAGTGACATTGTGGCTGG + Intergenic
1146653870 17:34623702-34623724 TTGCACAGTGAGTCTGTGGCAGG + Intronic
1146692653 17:34887443-34887465 TTGAGCACCGACTTTGTAGCCGG + Intergenic
1149146081 17:53494731-53494753 TTGAACAGTGTCTATGTGCCAGG - Intergenic
1149148514 17:53530314-53530336 TTGAGCACTTACTATGTGGCAGG + Intergenic
1150092338 17:62338679-62338701 TTGATCACTGGCTATGTGCCAGG + Intergenic
1150758343 17:67936755-67936777 TTCATCATTGACTCTGTGCCAGG + Intronic
1150836610 17:68569739-68569761 TAGATCATTGCCTTTGTAGCTGG - Intronic
1151705960 17:75767485-75767507 TTGATCAGTTAGGTTGGGGCAGG + Intergenic
1151969964 17:77452571-77452593 TTGAGCAGTGGTTTTCTGGCAGG + Intronic
1152212705 17:79011012-79011034 TTGATCAGTGAGGGTGGGGCAGG - Intergenic
1153153093 18:2117041-2117063 TTGGTCAGTGATTTTCTTGCAGG - Intergenic
1153264382 18:3255115-3255137 TTGAGCACTAACTATGTGGCAGG - Intronic
1155907714 18:31472301-31472323 TTGACCTGTGACTGTGGGGCAGG + Exonic
1157601385 18:48895059-48895081 TTGAGCAGTGATTTAATGGCTGG - Intergenic
1157862720 18:51155281-51155303 TGGATCAGAAACTTTGTGGGTGG - Intergenic
1158112868 18:53961139-53961161 TTGAGCACCGACTGTGTGGCAGG - Intergenic
1158200384 18:54932581-54932603 TAGTTCAGTGACTTTCTGGAGGG - Intronic
1158716595 18:59885783-59885805 TGATTCAGTGACTTTCTGGCAGG - Intergenic
1159500948 18:69268936-69268958 TTCTTCAGTGTCTATGTGGCAGG + Intergenic
1160025283 18:75211188-75211210 TTGATCTGTGACTGTTTGGAAGG + Exonic
1161658296 19:5529635-5529657 TTGAGCAGTGGCTCTGTGGGGGG + Intergenic
1162266766 19:9582355-9582377 TTGATCAGTTAGGTTGGGGCAGG - Intronic
1164847344 19:31444915-31444937 TTGCTCAGTGGCTTTATGTCAGG + Intergenic
1165615014 19:37192091-37192113 TTGATCAGCCACTGTGTGGCAGG - Intronic
1165777591 19:38413701-38413723 TTGATCATTGACTGTGTGCCAGG - Intronic
1165995036 19:39838011-39838033 TTGGCCAGTGACTTTATGTCTGG - Intronic
1167712762 19:51122702-51122724 TTGTTCAGGGTCTTTGGGGCTGG - Intergenic
1168052894 19:53842976-53842998 TTGATAAGACAGTTTGTGGCTGG - Intergenic
927882231 2:26696959-26696981 TTTATTATTTACTTTGTGGCAGG + Intronic
929359584 2:41070038-41070060 TTGATCATTTACTATGTGTCAGG - Intergenic
929679979 2:43983755-43983777 TTGATCATTCAATTTGTGACTGG - Intronic
930059171 2:47274105-47274127 TTGAGCACTGACTATGTGCCAGG - Intergenic
931173379 2:59828805-59828827 TCGAGCAGGGACTTTGAGGCTGG - Intergenic
931284132 2:60818491-60818513 ATGATCACTGACTTTGGGGTGGG - Intergenic
931768225 2:65475682-65475704 TTGATCACTTACTCTGTGACAGG + Intergenic
932579159 2:72982506-72982528 TTGAGCACTGACTGTGTGCCAGG + Intronic
933152286 2:78930159-78930181 TTGAGCACTGACTATGTGCCAGG - Intergenic
933984439 2:87578923-87578945 TTGCTCTGAGACTGTGTGGCTGG + Intergenic
935801867 2:106705755-106705777 TTGCTCATTGACTTTCTGGAGGG - Intergenic
937241423 2:120464932-120464954 CTGAACAGTGACTTGGTGTCAGG + Intergenic
938134682 2:128746196-128746218 TTGATTACTTACTTTGTGCCAGG - Intergenic
938398250 2:130966119-130966141 TTCCTCAGTGCCTCTGTGGCTGG - Intronic
941094681 2:161224435-161224457 TTTATCACTTACTTTGTGCCTGG + Intronic
941375798 2:164728703-164728725 TTGATAAATGACTATGTGCCAGG - Intronic
942377852 2:175355430-175355452 CGGATCAGTCACTTTCTGGCTGG + Intergenic
942892488 2:181008260-181008282 TTGACCAATTACTATGTGGCAGG + Intronic
943764611 2:191647314-191647336 TTGAGCATTTACTTTGTGACAGG + Intergenic
1168880278 20:1200567-1200589 TTGATCAGTGGAGTTGTGACTGG + Intergenic
1168909980 20:1439935-1439957 TTGAGCACTCACTTTGTGCCAGG - Intergenic
1170365363 20:15592246-15592268 TTGAGCAGTGACTATGTACCAGG - Intronic
1170693599 20:18637285-18637307 TTCATCACTGCCTGTGTGGCAGG - Intronic
1170699049 20:18686927-18686949 TTTAGCACTGACTTTGTGCCAGG + Intronic
1171147733 20:22800496-22800518 TTGATGACTGACTTTGTAACGGG + Intergenic
1171228288 20:23459722-23459744 TTGAGCAATGACTTTGTGTCAGG - Intergenic
1173102765 20:40102901-40102923 TTGATTTGTCACTTTGTAGCTGG + Intergenic
1173600067 20:44288457-44288479 TTGCTCAGTGACTTAGTGAAAGG + Intergenic
1173722703 20:45273421-45273443 TTGAGCACTGACTATGTGTCAGG - Intergenic
1174197172 20:48781683-48781705 TTCCACAGTGAGTTTGTGGCAGG - Intronic
1175231856 20:57478841-57478863 TTGAGCATTTACTCTGTGGCAGG + Intergenic
1176186845 20:63784935-63784957 TAGAAAAGAGACTTTGTGGCCGG + Intronic
1178163015 21:29940074-29940096 TTGATCAGTGGGGTTGGGGCGGG - Intergenic
1181975780 22:26728567-26728589 TTGAGCACTTACTTTGTGCCAGG + Intergenic
1182524948 22:30909365-30909387 TTGAGCACTGACTATGTGCCAGG - Intergenic
1182659058 22:31912247-31912269 TGACTCAGTGACTTTGAGGCAGG + Intergenic
1184296786 22:43530103-43530125 CTGATCTGTGACTCTGTGGAGGG + Intronic
1184806072 22:46795668-46795690 TTGATCATTTACTGTGTGGCAGG + Intronic
949790801 3:7790052-7790074 TTGATCACTTACTTTGTGTCAGG + Intergenic
952180428 3:30910988-30911010 TTGAGCAGTTAAATTGTGGCTGG + Intergenic
952995429 3:38876672-38876694 TTGATTAGTGCCATTGTTGCAGG - Intronic
953662802 3:44903369-44903391 TTGATCAGCAACTTTGTAACTGG - Intronic
953715117 3:45310998-45311020 TTGAGCAATGATTTTGTGCCAGG - Intergenic
954197076 3:49003250-49003272 TGGAACAGTGGCTTTGCGGCTGG + Intronic
954434902 3:50490786-50490808 CTGCTCAGGGACTATGTGGCTGG - Intronic
955745881 3:62140107-62140129 TTAAACAGTGAATGTGTGGCTGG - Intronic
957472387 3:80675487-80675509 TTGATCATTTAATTTGTGCCAGG - Intergenic
958012504 3:87897961-87897983 TTGATCACTGAATCTGTGCCAGG - Intergenic
959204716 3:103291557-103291579 TTGTTCAGTGACTTTGAGAATGG - Intergenic
959752626 3:109856136-109856158 CTGAGCAGTGAGTTTGTGGAGGG + Intergenic
961107597 3:124255459-124255481 TTGAGCATTTACTTTGTGGCTGG - Intronic
962741308 3:138364354-138364376 TTGAACAGTCACTATGTGCCAGG + Intronic
963324954 3:143852241-143852263 TTGAACAGTGAATTTGGGGTGGG - Intergenic
963917865 3:150876589-150876611 TACCTCAGTGACTTAGTGGCAGG + Intronic
965685727 3:171300206-171300228 TTTATAAGTAACTTTATGGCTGG + Intronic
966679948 3:182631379-182631401 TTGAGCAATGACTATGTGCCAGG + Intergenic
967084401 3:186080746-186080768 TTGATCTGTGGCTTTGAGGCAGG - Intronic
967361208 3:188634292-188634314 TTGATCACTTACTGTGTGCCAGG + Intronic
969654762 4:8490231-8490253 TTGAGTAGTGACTCTGTGTCTGG + Intronic
970512226 4:16792753-16792775 TTGCTCAGTGACTTACAGGCAGG + Intronic
970604790 4:17668866-17668888 TTGATCACTTACTATGTGCCAGG + Intronic
971878120 4:32330356-32330378 TTGCTCACTGACTTTGTGCAGGG + Intergenic
972298206 4:37760517-37760539 TTGATCAGTTACTGTATGTCAGG + Intergenic
972789788 4:42360354-42360376 TTGCTCTCTGACTTTTTGGCTGG - Intergenic
973256631 4:48119748-48119770 TTGAAGAGTGACTTTTTGGCAGG - Intronic
973959149 4:56092165-56092187 GTGATGAGTGACTTTGTGCCAGG + Intergenic
978194839 4:105959052-105959074 TTGACCATGGACTTTGTGGATGG + Exonic
980753450 4:137123858-137123880 TTGATCTGTTTCTTTGTAGCAGG + Intergenic
983482079 4:168287113-168287135 TTGGTCAGAGACTTTGAGGTTGG - Exonic
986254703 5:6092403-6092425 TTGATCAGTTAGGTTGGGGCAGG + Intergenic
987665954 5:20939869-20939891 ATGATCAGTGACTTTCTTTCAGG - Intergenic
989354865 5:40532213-40532235 TTGAACAATTACTGTGTGGCAGG - Intergenic
989632601 5:43501419-43501441 TTGAACAGTAACTCTTTGGCAGG - Intronic
992869007 5:80987265-80987287 TTGAGCACTGACTGTGTGCCAGG + Intronic
994399973 5:99266329-99266351 TTGATGTGTGACTTTATGTCTGG + Intergenic
994930418 5:106175781-106175803 TTGATCAGTCACTTTCTTGATGG + Intergenic
995103234 5:108342076-108342098 TTGAACAGTTACTATGTGCCAGG - Intronic
995195804 5:109366720-109366742 TTGAGCATTTACTTTGTGCCAGG - Intronic
998523394 5:142820389-142820411 CTGATCAGTCATTTTGTGGTTGG + Intronic
999492887 5:152068956-152068978 TAGATCATTGACTTTGGAGCAGG - Intergenic
1000035460 5:157444386-157444408 TTGATCACTGACAGTGTGCCGGG - Intronic
1001049156 5:168400499-168400521 TTGAGCAGTTACTCTGTGCCAGG + Intronic
1001147949 5:169201145-169201167 TTGATCAATGACATTTAGGCTGG + Intronic
1001401750 5:171450389-171450411 TTGAGCACTGACTTTCTGCCCGG + Intronic
1004544052 6:16579762-16579784 TTGAGCATTGACTATGTGCCAGG + Intronic
1006003372 6:30983941-30983963 TTCATCTGTCTCTTTGTGGCTGG - Exonic
1006446075 6:34080480-34080502 TTGAGCACTGACTATGTGCCAGG - Intronic
1007849982 6:44793525-44793547 TTGATCAGTGCCTCTGGGCCTGG + Intergenic
1008251979 6:49251329-49251351 TTGAGCAGTTCCTTTGTGCCAGG - Intergenic
1010024459 6:71199514-71199536 TTGAGCACTGACTCTGTGCCAGG - Intergenic
1012030830 6:94060384-94060406 TGAATCAATGAGTTTGTGGCAGG + Intergenic
1012586368 6:100927824-100927846 TTGACCACTCACTTTGTTGCTGG + Intergenic
1014005053 6:116408413-116408435 TTAATTAGTGTCTTTGTGGCAGG - Intronic
1014145485 6:117993478-117993500 TTGAGCAGTTACTGTGTGGCAGG + Intronic
1016934183 6:149436589-149436611 TGGCCCAGTGGCTTTGTGGCTGG + Intergenic
1016939690 6:149473959-149473981 TTGATCACTTACTCTGTGTCAGG + Intronic
1017762865 6:157584498-157584520 TTGATCCCTGAATTTGGGGCAGG + Intronic
1021245002 7:18250588-18250610 TTGAGCAGTGACTATGTGTAAGG - Intronic
1024217240 7:47257605-47257627 TTGAGCATTTACTTTGTGCCAGG - Intergenic
1025282349 7:57637364-57637386 TTGAGCAGTTACTATGTGCCAGG + Intergenic
1025302380 7:57828155-57828177 TTGAGCAGTTACTATGTGCCAGG - Intergenic
1028093521 7:86732564-86732586 TTGAGCATTTACTATGTGGCAGG + Intronic
1028520973 7:91730469-91730491 TTGCTCAGTAACTTAGCGGCAGG - Intronic
1029826616 7:103203241-103203263 TTGCTCATTGACAATGTGGCTGG + Intergenic
1031237408 7:119194849-119194871 TTGTCCAGTAACTTTCTGGCTGG - Intergenic
1031500607 7:122510487-122510509 TTGAACAATGACTTTGCAGCTGG + Intronic
1032348240 7:131136677-131136699 TTGTTCAGTTACTTTATGGCTGG - Intronic
1032763124 7:134963900-134963922 TAGAAAAGGGACTTTGTGGCTGG + Intronic
1038898373 8:31813467-31813489 TTGATCATTGACTTTGCTACAGG + Intronic
1039484833 8:37902258-37902280 TTGAGCATTTACTTTGTGCCAGG + Intergenic
1043511935 8:80958358-80958380 TTGAACAGTCATCTTGTGGCAGG + Intergenic
1043582526 8:81730794-81730816 TTGAGCACTGACTATGTGTCAGG - Intronic
1043721474 8:83550379-83550401 TTGATCAGTTAGGTTGTGGCAGG - Intergenic
1044066139 8:87702794-87702816 CTGGGCAGTGCCTTTGTGGCAGG + Intergenic
1044820307 8:96151804-96151826 CTGATCTGTGACTTAGTGGCTGG + Intronic
1045519113 8:102887878-102887900 TTGAGCACTTACTTTGTGCCAGG - Intronic
1045817986 8:106299717-106299739 TTGAGGACTGACTTTGTGTCAGG + Intronic
1045871146 8:106928262-106928284 TTGATCACTTACTCTGTGCCAGG + Intergenic
1046918012 8:119697841-119697863 TGGAGCATTGACTTTGTGTCAGG - Intergenic
1048503036 8:134996014-134996036 TTGAGCACTTACTTTGTGCCAGG - Intergenic
1050020816 9:1282892-1282914 TTGAGCACTGACTCTGTGGTAGG - Intergenic
1051083969 9:13325574-13325596 TTGAGCACTGACTTTATGTCAGG - Intergenic
1051243989 9:15090762-15090784 TTGGGCAGTGACTTGGTTGCTGG - Intergenic
1051541915 9:18229551-18229573 GAGCTCAGTGACTTTTTGGCAGG + Intergenic
1051591326 9:18778666-18778688 TTGATTAGTGACTATCTGCCAGG + Intronic
1051626224 9:19102402-19102424 TTGAGCAGTTACTCTGTGCCAGG - Intronic
1051863604 9:21653752-21653774 TTGATCACTTACTTTGTGACAGG - Intergenic
1056151487 9:83794430-83794452 TTTATCATTAACTGTGTGGCTGG - Intronic
1056303337 9:85264604-85264626 CTGACCAGTGACTATCTGGCTGG - Intergenic
1056811494 9:89768551-89768573 TTGCTCACTGACTTTCTGGTGGG + Intergenic
1057337035 9:94163924-94163946 TTGATCAGTGGCATTGTAGAAGG - Intergenic
1058274266 9:103020994-103021016 TTGATCAGTGAAGCTGTGTCCGG + Intergenic
1059260785 9:112974492-112974514 TTGATAATTGTCTTTCTGGCTGG - Intergenic
1060071592 9:120554394-120554416 TTGAACAGTGACTTTGAGAATGG - Intronic
1060684326 9:125594525-125594547 TTGATCAGTGACTTTGTGGCAGG - Intronic
1061321959 9:129836286-129836308 TTAAGCAGTTACTATGTGGCAGG + Intronic
1062022325 9:134325594-134325616 TTGGACACAGACTTTGTGGCCGG - Intronic
1185823233 X:3224920-3224942 TTGAGCTGTGTCTTTGTGTCAGG - Intergenic
1188540981 X:31250044-31250066 TTGTTCATTGACTTTGAGGCTGG - Intronic
1194454807 X:94089847-94089869 TTGATCACTTACTGTGTGCCAGG + Intergenic
1194742206 X:97587083-97587105 TTGAACATTGACTATGTGCCTGG - Intronic
1194931671 X:99896060-99896082 TTGCTTGTTGACTTTGTGGCTGG - Intergenic
1198068064 X:133119689-133119711 TTAATCAGTTACTATGTGTCAGG - Intergenic
1199412842 X:147544853-147544875 TTGAACAGCCACATTGTGGCAGG - Intergenic
1199971708 X:152866461-152866483 TTAAGCACTTACTTTGTGGCAGG - Intronic
1199981360 X:152922302-152922324 TTCCTCAGTGACTGAGTGGCAGG - Intronic
1201573449 Y:15437832-15437854 TTGAACAGTGACAGTGTAGCAGG - Intergenic