ID: 1060688580

View in Genome Browser
Species Human (GRCh38)
Location 9:125635439-125635461
Sequence CAGCCTGAACATAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060688580 Original CRISPR CAGCCTGAACATAGGGTGGA AGG (reversed) Intronic
902963178 1:19978903-19978925 CACCCTGGACTTAGGTTGGATGG - Intronic
906544140 1:46609598-46609620 CGATCTGAACATAGGGTGGCTGG - Exonic
906928688 1:50147426-50147448 AAACCTGAACAACGGGTGGATGG - Intronic
908135458 1:61127595-61127617 CAGCCAGAAGATATGGTGAATGG + Intronic
909489937 1:76215022-76215044 TAGCATGAACATAGCCTGGAAGG + Intronic
910962562 1:92778291-92778313 CTGCCAGAACAAAGAGTGGAAGG + Intronic
913112680 1:115670626-115670648 CATCGTGAACATGGGATGGAGGG - Intronic
916025638 1:160831012-160831034 CAGCTTGAAAATCAGGTGGAGGG + Intronic
916150938 1:161789343-161789365 AATCATGAACATAGGGTAGAAGG - Intronic
916683324 1:167123504-167123526 TAGCCTGGTCAGAGGGTGGAGGG + Intronic
916714268 1:167435962-167435984 CAGCCTGGACAGGGGCTGGATGG + Intronic
919540370 1:198837821-198837843 CTGCCTAACCATGGGGTGGAAGG - Intergenic
919814878 1:201431081-201431103 CAGGCTGGGCACAGGGTGGAGGG - Intergenic
922547233 1:226466999-226467021 CTGCCTGAACTGAGGGTGGGAGG + Intergenic
922609129 1:226911421-226911443 CAGCTTGAACATAGTGAGGGTGG + Intronic
923432147 1:233933231-233933253 CAGCTTGAACAAAGGTTTGAGGG + Intronic
1070707142 10:78647907-78647929 GAGCATGAACACAGAGTGGAGGG - Intergenic
1070858652 10:79630148-79630170 CAGCCTGGACAAAGGCTGGAAGG + Intergenic
1072905956 10:99454098-99454120 GAGGCTGAGCATAGGGTGGGAGG - Intergenic
1075662423 10:124207284-124207306 CAGCATGAACAGAGGTTGGCGGG + Intergenic
1075680131 10:124325593-124325615 CAGCCTATACAAAGGCTGGAAGG - Intergenic
1075953345 10:126501217-126501239 CAGCCTGCACAACGTGTGGAGGG - Intronic
1076988029 11:253405-253427 CAGAGTGAACATTAGGTGGAAGG + Intergenic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1083265992 11:61547020-61547042 CGGCCTGCCCATGGGGTGGATGG + Intronic
1083341664 11:61962252-61962274 CAGCCTGAACAAAGAGGAGATGG + Exonic
1087725986 11:101717256-101717278 CTGACTGAATATAGAGTGGAAGG - Intronic
1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG + Intronic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1089836152 11:121372497-121372519 CAGCCTGAAGATAGGGTTCCAGG - Intergenic
1091803867 12:3342410-3342432 CAGCCTGAACAAAGGGCCAAAGG - Intergenic
1092064678 12:5579937-5579959 AAGCCTGAACACAGGGTGGTGGG - Intronic
1093800019 12:23361882-23361904 CTGTCGGAACATAGGGTAGAAGG - Intergenic
1098451567 12:70624082-70624104 TACCCTGAACATAAGGTCGATGG + Intronic
1099943266 12:89215711-89215733 CAGCATGAACAGAGAGTTGACGG + Intergenic
1104670298 12:130675579-130675601 CACCCAGAGCTTAGGGTGGACGG - Intronic
1106125174 13:26895416-26895438 CCGCCTGAAAATACGGTGGAGGG - Intergenic
1118464060 14:66014841-66014863 CTGCCTGAAAATAGAGAGGAGGG + Intergenic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1122782217 14:104148577-104148599 CAGCCTGTGCAGAGGTTGGAAGG + Intronic
1126107406 15:45155776-45155798 CAAAATGAATATAGGGTGGAAGG - Intronic
1127806814 15:62528788-62528810 CAGTCTGAACACAGATTGGAAGG - Intronic
1129881876 15:79012211-79012233 CAGCATGAACATAGGTTCGGAGG - Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1135910431 16:26555733-26555755 CAGCCTCAAGGTGGGGTGGAAGG - Intergenic
1137232016 16:46575095-46575117 CAGCCTGAAGCTAGGGGTGAGGG + Intergenic
1139680610 16:68559010-68559032 CAGCATGAACATGAGATGGAAGG - Intronic
1141355596 16:83343378-83343400 CTGCCTGAACATCCAGTGGAAGG - Intronic
1153381875 18:4449369-4449391 CAGCCTGAATATAAGGTGATGGG - Intronic
1154508778 18:15071304-15071326 CAGACTGAAAATAAGGTGCAAGG - Intergenic
1157551346 18:48583761-48583783 CAGCCTGAACTGAGCATGGATGG + Intronic
1162539291 19:11284522-11284544 CAGTCTGAACACAGCCTGGAAGG + Intergenic
1163878874 19:19900490-19900512 CACCCTGAACAAAGGAGGGAAGG - Intergenic
1164753711 19:30674299-30674321 CAGCCTGGGCACAGGGTGCATGG - Intronic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1166938588 19:46349820-46349842 CTGCCTGGAGAGAGGGTGGACGG + Intronic
1167116698 19:47492796-47492818 CAGGCTGAAGACAGGGTGGGGGG + Intronic
1168102442 19:54148354-54148376 CAGCCTGGGCATAGGGAGCAGGG - Exonic
926869673 2:17400156-17400178 AAGCATGAATATAGGGTAGAAGG - Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
932120105 2:69090898-69090920 CCTCCTGCACATATGGTGGATGG - Exonic
934980277 2:98833744-98833766 CTGCCTGAACAATAGGTGGAAGG + Intronic
936474011 2:112824051-112824073 CAGCATGAACAATGGGTGGAGGG - Intergenic
946312192 2:218888462-218888484 CCTCCTGAACATCTGGTGGAAGG + Intronic
1171374210 20:24681136-24681158 CAGCCTCCACATAGGGTAGCAGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172881486 20:38202704-38202726 CAGCCTGACCTGGGGGTGGAGGG + Intergenic
1173339145 20:42138268-42138290 CAGGCAGAAGATTGGGTGGAGGG + Intronic
1175478679 20:59296006-59296028 CAGTCTAAAAATAGGTTGGAAGG + Intergenic
1175952220 20:62589504-62589526 CAGCCTGAACTTAAGGGGGGCGG + Intergenic
1175992664 20:62797153-62797175 CAGCCAGAACATCGGGCGGCAGG + Exonic
1176789295 21:13300445-13300467 CAGACTGAAAATAAGGTGCAAGG + Intergenic
1178818279 21:35951523-35951545 CAGCACAGACATAGGGTGGAAGG - Intronic
1179435682 21:41360602-41360624 CTGCCTTGACAGAGGGTGGAGGG + Intergenic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1183789113 22:40050597-40050619 CAGTCTTAACTGAGGGTGGATGG - Intronic
1184002029 22:41682135-41682157 GAGGCTGGACATAGGGTGGACGG + Intronic
1184210722 22:43034085-43034107 GAGCCTGCACACCGGGTGGAAGG - Intergenic
1184535622 22:45084858-45084880 CTGCCTGCACTTAGGGTGGAAGG - Intergenic
1184910022 22:47525559-47525581 CAGACTGAACACAGTGGGGATGG + Intergenic
950430532 3:12948383-12948405 GAGCCTGACCCCAGGGTGGAGGG + Intronic
950607642 3:14096874-14096896 CAGCCTGAGCAGCAGGTGGATGG + Intergenic
952903280 3:38123350-38123372 CACCCTGAACTTAGGATGTAGGG - Exonic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
955223640 3:57043581-57043603 CAGCCTGAGCATATCATGGAAGG + Intronic
959337120 3:105080088-105080110 CAGCCTGACCACATGGTAGAAGG - Intergenic
959343762 3:105165627-105165649 CAGCATGAACACAGGGAGTAAGG - Intergenic
960040766 3:113148179-113148201 CAGCCTGGAGGCAGGGTGGAGGG - Intergenic
961371587 3:126434957-126434979 CAGCCTGAACCCAAGGTAGATGG + Intronic
962873307 3:139516942-139516964 CAGCCCGTAGATGGGGTGGATGG + Intergenic
965809026 3:172573784-172573806 CAGCCTGACCATCCAGTGGAGGG + Intergenic
972016575 4:34253792-34253814 CTGTCTCAACATAGAGTGGAGGG + Intergenic
975033022 4:69647059-69647081 CAGCAGGAACATAGGAAGGAGGG + Exonic
976147096 4:82052565-82052587 CAGCCTCACCATAGGGTGAGAGG + Intergenic
978518469 4:109594730-109594752 CAGCCTGAAGTGAGGATGGAAGG + Intronic
981389534 4:144172310-144172332 GATCCTGGACATAGGGAGGAAGG + Intergenic
985279034 4:188269045-188269067 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279050 4:188269095-188269117 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279066 4:188269145-188269167 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279082 4:188269195-188269217 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279098 4:188269245-188269267 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279114 4:188269295-188269317 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279130 4:188269345-188269367 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279146 4:188269395-188269417 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279162 4:188269445-188269467 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279178 4:188269495-188269517 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279194 4:188269545-188269567 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279210 4:188269595-188269617 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279226 4:188269645-188269667 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279242 4:188269695-188269717 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279258 4:188269745-188269767 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
986178164 5:5369541-5369563 CAGCCTGCACTTATGGTGGAGGG + Intergenic
989626371 5:43432950-43432972 CAGCATGCACATAAAGTGGAAGG - Intergenic
990991602 5:61689879-61689901 CAACATGGACATAGGGTGGGTGG - Intronic
992547622 5:77830028-77830050 AAGTCTGAACATTGGGTGGAAGG - Intronic
995637303 5:114208409-114208431 CAGCATTAGCATAGAGTGGAGGG - Intergenic
996709025 5:126525731-126525753 CAGCCTGCACACTGGGAGGATGG + Intergenic
1000257112 5:159550176-159550198 CATCTTGAAAATTGGGTGGAAGG + Intergenic
1000395778 5:160773339-160773361 GAGCCTGAAAACAGGCTGGATGG + Intronic
1003037189 6:2652511-2652533 TACCCTTAACAAAGGGTGGAAGG + Intergenic
1003424161 6:5985892-5985914 CAGCCTGAGTATAGGGTAGCAGG + Intergenic
1007975644 6:46098675-46098697 CAGCCTGGACAGGGAGTGGAAGG + Intergenic
1008547477 6:52595993-52596015 CAGCCTGAACAGAGAGTTGGGGG - Intergenic
1011227014 6:85118726-85118748 CAGCCTGAACCCATGGTGTAGGG - Intergenic
1018806690 6:167267392-167267414 CACCTTGAACCTAGGGTGGAAGG - Intergenic
1022387388 7:29914574-29914596 CAGCTTGAGCATGGGGTGGGTGG - Exonic
1023141250 7:37104615-37104637 CAGCCTGGACATACCATGGATGG - Intronic
1025300378 7:57815182-57815204 CAGGCTGAACACAACGTGGAAGG + Intergenic
1031526877 7:122833101-122833123 CAGACAGAACAAAGGCTGGAAGG - Intronic
1036750896 8:11443259-11443281 CAGCCTGAGAACAGGGTGGGGGG - Intronic
1036913186 8:12776524-12776546 CAGAATGAAAATAGAGTGGATGG + Intergenic
1037501918 8:19494848-19494870 TACTGTGAACATAGGGTGGAGGG - Intronic
1039709697 8:40043231-40043253 CAGAATGAAAATAGGGTGGTGGG - Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1041889664 8:62855258-62855280 CAGCCTGGCCACAGTGTGGAAGG + Intronic
1042462101 8:69081381-69081403 TAGCCTGAACTGAGTGTGGAAGG + Intergenic
1047192810 8:122693672-122693694 CAGCCTGAACATAGAGAGGCAGG + Intergenic
1048157135 8:131967412-131967434 CAGCCTGAAAACAGGGCAGAGGG + Intronic
1048922316 8:139242350-139242372 CAGCCTCACTATAGAGTGGATGG + Intergenic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049239355 8:141529054-141529076 CAGCCTCAGCATTTGGTGGACGG - Intergenic
1049280451 8:141741460-141741482 CAGCTGGAACATAGAGAGGAAGG - Intergenic
1049606257 8:143530507-143530529 CAGCCTGGGCACAGGGTGGTGGG + Intronic
1050664658 9:7921809-7921831 AAGCCTGAAGAAAGAGTGGAAGG - Intergenic
1056313207 9:85363118-85363140 CAGACAAAACATAGAGTGGAAGG + Intergenic
1056898311 9:90572592-90572614 CAATTTGAACATTGGGTGGATGG + Intergenic
1057075863 9:92137888-92137910 CAGCCTGGACCTAGGGAGGGAGG - Intergenic
1059329118 9:113524059-113524081 CAGCCTGACCACAGGGCGGTGGG + Intronic
1059860000 9:118449297-118449319 CAGCCTGAACATAGTTAGAAGGG + Intergenic
1060688580 9:125635439-125635461 CAGCCTGAACATAGGGTGGAAGG - Intronic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1186302977 X:8220408-8220430 CAGTCTGAACATTGGGTAGATGG + Intergenic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1194916986 X:99719309-99719331 CAGCCTGGCCACAGTGTGGAAGG + Intergenic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1195861703 X:109390007-109390029 CAGCCTGCACACAGGAAGGAAGG + Intronic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic