ID: 1060695699

View in Genome Browser
Species Human (GRCh38)
Location 9:125707191-125707213
Sequence TCCGGGTCGTGTGCGGCTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060695699_1060695711 11 Left 1060695699 9:125707191-125707213 CCCCGAGCCGCACACGACCCGGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1060695711 9:125707225-125707247 GCGTTCCGGAAGTCCCCGACCGG 0: 1
1: 0
2: 0
3: 5
4: 18
1060695699_1060695719 29 Left 1060695699 9:125707191-125707213 CCCCGAGCCGCACACGACCCGGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1060695719 9:125707243-125707265 ACCGGGAAGGAGCCTCTGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 200
1060695699_1060695714 16 Left 1060695699 9:125707191-125707213 CCCCGAGCCGCACACGACCCGGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1060695714 9:125707230-125707252 CCGGAAGTCCCCGACCGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1060695699_1060695712 12 Left 1060695699 9:125707191-125707213 CCCCGAGCCGCACACGACCCGGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1060695712 9:125707226-125707248 CGTTCCGGAAGTCCCCGACCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1060695699_1060695706 -3 Left 1060695699 9:125707191-125707213 CCCCGAGCCGCACACGACCCGGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1060695706 9:125707211-125707233 GGAACCACACCCCGGCGTTCCGG 0: 1
1: 0
2: 1
3: 2
4: 63
1060695699_1060695721 30 Left 1060695699 9:125707191-125707213 CCCCGAGCCGCACACGACCCGGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1060695721 9:125707244-125707266 CCGGGAAGGAGCCTCTGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 236
1060695699_1060695717 25 Left 1060695699 9:125707191-125707213 CCCCGAGCCGCACACGACCCGGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1060695717 9:125707239-125707261 CCCGACCGGGAAGGAGCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060695699 Original CRISPR TCCGGGTCGTGTGCGGCTCG GGG (reversed) Exonic