ID: 1060700785

View in Genome Browser
Species Human (GRCh38)
Location 9:125747499-125747521
Sequence CTGGCTGGCCACTCGGTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060700775_1060700785 9 Left 1060700775 9:125747467-125747489 CCAGGATGCTGCAGACTCTGGCC 0: 1
1: 0
2: 4
3: 31
4: 228
Right 1060700785 9:125747499-125747521 CTGGCTGGCCACTCGGTGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060700785 Original CRISPR CTGGCTGGCCACTCGGTGCA GGG Exonic
900164365 1:1238836-1238858 TTGGCTGGCCACTCAGTGCCTGG - Intergenic
901690321 1:10969047-10969069 CTGGCTGGCCAATGGGTGGTTGG + Intronic
902514857 1:16984702-16984724 CTGGCTGGCAACACAGTGCCAGG + Intergenic
902612957 1:17607949-17607971 CTGGAAGGACACTCGGTGCTTGG - Exonic
904585427 1:31577188-31577210 CTGGCTGGCCACTTGGCTCTGGG + Exonic
905688999 1:39928953-39928975 CTGGCTGGGCACAGGGTGCCTGG - Intergenic
905789078 1:40780886-40780908 CCGGCTGGGCACTGGGTGCTGGG - Intergenic
906047898 1:42846769-42846791 TTGGCTTCCCACTCGGTCCAGGG - Intronic
906125450 1:43424448-43424470 CTGCCAGGTCACTCGGGGCAAGG + Intronic
906396471 1:45470740-45470762 TTGGGTAGCCACTAGGTGCAAGG + Intronic
907516899 1:54998589-54998611 CTGGCTGGTGACTATGTGCAGGG - Intergenic
907931571 1:59005760-59005782 CTGGCTGGCTGCTCAGGGCAGGG + Intergenic
912174517 1:107140384-107140406 CTCGCTGCCCGCTCGGAGCAGGG + Intronic
913653471 1:120939994-120940016 ATGCCTGGCCACTGGGTGAAAGG + Intergenic
914167626 1:145189034-145189056 ATGCCTGGCCACTGGGTGAAAGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914519162 1:148400118-148400140 ATGCCTGGCCACTGGGTGAAAGG + Intergenic
914643655 1:149634153-149634175 ATGCCTGGCCACTGGGTGAAAGG + Intergenic
915274296 1:154777326-154777348 CTGACTGCCCACTCTGTGCCAGG - Intronic
919775371 1:201190926-201190948 CTGGCTGCCCACCCGGGCCAGGG + Intronic
919861097 1:201739983-201740005 CTGGGTGCCCACCCGGTGAATGG + Intronic
923068237 1:230539499-230539521 CTTGCTGGCCAGTTGGTGTAAGG + Intergenic
1066228859 10:33412293-33412315 CTGGATGGCCACTCTCTGCAAGG + Intergenic
1067120886 10:43471273-43471295 CTGGCTGGCCATTCTGGACACGG - Intronic
1067153014 10:43751917-43751939 CTGGCTGGGTATTCTGTGCACGG + Intergenic
1070652963 10:78251459-78251481 CTGGACGGCCACTGTGTGCATGG + Intergenic
1071055686 10:81505909-81505931 CCGGCTGGCCGCTCTGAGCACGG - Intergenic
1071439425 10:85677309-85677331 CTTGCTGGCCACTGTGTGCCAGG - Intronic
1074747378 10:116548461-116548483 CTGGCTGGCCAATGTGTGCAAGG + Exonic
1075612597 10:123865634-123865656 CTGGCTGCCCACTGGGATCAGGG + Intronic
1075667962 10:124244347-124244369 CTTGCTGGGAACTCGGTGGAAGG + Intergenic
1078747726 11:14131428-14131450 CTGGCAGGCTAGTCGGAGCAGGG - Intronic
1078897349 11:15608573-15608595 CTGGCTGACTACTAGGTGCTAGG + Intergenic
1084267148 11:68010887-68010909 CTGGCTGGCCACTCCTTTCTTGG - Intronic
1084312444 11:68324890-68324912 CTGGCACGCCACTGGGTGCTAGG + Intronic
1084741090 11:71140039-71140061 CTGGCTGGCTCCTCCGGGCAGGG + Intronic
1085250001 11:75136824-75136846 CTGGCTTTGCACTGGGTGCATGG + Intronic
1088849116 11:113690809-113690831 CTCCCTGGGCCCTCGGTGCAGGG - Intronic
1090574497 11:128086372-128086394 CTGCCTGGCTACTAGTTGCAGGG + Intergenic
1090647506 11:128777627-128777649 CTGGCTGACTACTGGGTCCAGGG - Intronic
1090904284 11:131061041-131061063 ATGGCTGTCCACTCTCTGCAGGG - Intergenic
1092117430 12:6019254-6019276 CTGGCTGGCCATCAGGAGCAGGG + Exonic
1099523612 12:83693715-83693737 CTGGTTGGACAATGGGTGCATGG + Intergenic
1102614024 12:114137494-114137516 CAGGCTTGTCACTCTGTGCAAGG - Intergenic
1103459292 12:121090924-121090946 CTGGCTGGGCAGTGGCTGCAGGG + Intergenic
1104446615 12:128839255-128839277 ATGGCTGGCCTCTCTGTCCAGGG + Intergenic
1104911966 12:132244086-132244108 CGGGCCGGCCACTCGGACCACGG + Intronic
1114050380 14:18916202-18916224 CTTGTTGACCACGCGGTGCAGGG + Intergenic
1114112178 14:19485730-19485752 CTTGTTGACCACGCGGTGCAGGG - Intergenic
1114273604 14:21120989-21121011 CTGGCTGGCCACTGGGTTGCAGG + Intergenic
1115398934 14:32937942-32937964 AAGGCTGGCTACTCAGTGCAGGG - Intronic
1115920543 14:38367596-38367618 CTGTCTGGCCACTTGGCACAGGG + Intergenic
1116891752 14:50275674-50275696 CTGGCTGGCAACTCCTTGCAGGG + Intronic
1117329443 14:54697852-54697874 ATGGCTGGCAACTTGGTGCTAGG + Intronic
1117882694 14:60327889-60327911 CTGGATGGCCACGCGGCGCTGGG + Intergenic
1123113436 14:105883330-105883352 CAGGCTGGCCACTCAGTGATGGG + Intergenic
1129676263 15:77633651-77633673 TCTGCTGGCCACTGGGTGCAGGG - Intronic
1129687827 15:77696547-77696569 CAGGCTGTCCACTCTGTGCTGGG - Intronic
1132679291 16:1133142-1133164 CGGGCTGGCCTCTGGGTGCTGGG + Intergenic
1132718437 16:1303865-1303887 CTGGCTGGACTCTCCCTGCATGG + Intergenic
1132834771 16:1947243-1947265 CTGGCTGAACACGCTGTGCACGG + Exonic
1137273631 16:46919111-46919133 CTGGCTGTGCTCTGGGTGCAGGG + Intronic
1139594298 16:67949079-67949101 CATGCTGGCCACTCCCTGCAAGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141301213 16:82817253-82817275 CTGTATGGCCACTGGGTGTAGGG - Intronic
1141559095 16:84854769-84854791 CTGGGTGGGCACTCAGAGCAGGG - Exonic
1142164764 16:88580305-88580327 CTGGCTGCCCACTATGTGCCAGG - Intronic
1142226642 16:88880860-88880882 CTGGCTGGGCCCTGAGTGCAGGG + Intronic
1144669642 17:17125717-17125739 CTGGATGGCCTCTGGGTGGAAGG + Intronic
1145248145 17:21283406-21283428 GTGGCTCCCCACTCTGTGCATGG + Intergenic
1147452172 17:40512468-40512490 CAGGCTTGCCACTCGGGTCATGG + Intergenic
1149792728 17:59493483-59493505 CAGGCAGTCCACTCAGTGCAAGG + Intergenic
1151426501 17:74034249-74034271 CTGGCTGGCTACTCAGTGTGTGG + Intergenic
1151478725 17:74357662-74357684 CTTGGTGGCCAGTCTGTGCAGGG + Exonic
1155972063 18:32092309-32092331 CGGGCTGGGCACTCGGGGCTCGG + Intronic
1157856912 18:51112083-51112105 CTGGCTGGCCGCTCCGAGCATGG + Intergenic
1158661290 18:59390572-59390594 CTGGCAGGCCACCCGAAGCAAGG + Intergenic
1159570825 18:70110382-70110404 CTGGTTGGACAGTGGGTGCAGGG + Intronic
1160826677 19:1083374-1083396 GGGGCTGGCCACTCGGGGCTTGG + Intronic
1162802879 19:13120569-13120591 CTGGCTAGCCACTTGGTTCTAGG + Intronic
1164594023 19:29521881-29521903 CTGGCTCCCCACTCCCTGCAGGG - Intergenic
1164752539 19:30667361-30667383 CTGGTTGGCCCTTGGGTGCAGGG + Intronic
1166812385 19:45522256-45522278 CTGGCTGGCCACTTCCTCCAGGG - Intronic
1167664987 19:50818648-50818670 CTGGCTGGGCACCAGGGGCAGGG - Intergenic
927514109 2:23661922-23661944 CTGGCTGTCCCCTTGGAGCATGG - Intronic
929768482 2:44870804-44870826 CTGGATGGCCAATCTGTGCTAGG - Intergenic
930108709 2:47659487-47659509 GGGGCTGGCAACTCGGTGTACGG + Intergenic
933940268 2:87239416-87239438 CTGAATGCCCACTCTGTGCAGGG + Intergenic
936080386 2:109428949-109428971 CTGGCTCGCCACTGAGTGCAGGG + Intronic
936352870 2:111726360-111726382 CTGAATGCCCACTCTGTGCAGGG - Intergenic
940749059 2:157603357-157603379 CTGACTGCCCACTATGTGCATGG + Intronic
946685175 2:222261187-222261209 CTGGCAGTCCACTGCGTGCATGG - Intronic
948863700 2:240764894-240764916 CAGGCTGGGAACTCGGGGCAGGG - Intronic
1169973881 20:11301897-11301919 CTGGCTGGGCCCTGGGTGGAGGG + Intergenic
1170745362 20:19093923-19093945 CTGGCTGGCCACACAGAGGACGG + Intergenic
1172385709 20:34532652-34532674 CTGGATGGCCACAATGTGCATGG - Intronic
1173806068 20:45926074-45926096 CTGGCTGGTCACTAGCTGCCAGG - Intergenic
1175544825 20:59771419-59771441 CTGCCTGGCCACTTCTTGCATGG + Intronic
1175606617 20:60316668-60316690 CTGGCTGGCCCCTCGGTGCTGGG - Intergenic
1178409828 21:32353876-32353898 CTGGCCGGCTAGTCTGTGCAGGG - Intronic
1180468856 22:15638576-15638598 CTTGTTGACCACGCGGTGCAGGG + Intergenic
1180568869 22:16697667-16697689 CTGGCTGGCCATCAGGAGCAGGG + Intergenic
1180631074 22:17230339-17230361 CTGATTGGCCACTCCTTGCAAGG - Intergenic
1180847844 22:18994168-18994190 CTGGGTGGCTGTTCGGTGCAGGG + Intergenic
1181266723 22:21634998-21635020 CTGGCTGACCACGCTTTGCAGGG - Exonic
1181399765 22:22644276-22644298 ATGGCCTGCCACTCAGTGCACGG + Intergenic
1182285794 22:29246116-29246138 CTGCCTGGACACTCCGTGCCTGG - Intronic
1184149955 22:42632021-42632043 CTGGGTGCCCACCCTGTGCAGGG - Intronic
1184644652 22:45889412-45889434 CTGGCTGGCCTCTCCATGCCTGG - Intergenic
950624647 3:14235979-14236001 CTGGCTGGCCACAGTGTGCCGGG - Intergenic
959067890 3:101676556-101676578 CGGGCTGGCGACTCGTTGCCTGG - Intronic
961134939 3:124501675-124501697 CTGGGAGGCCACTAGATGCAAGG + Intronic
962319559 3:134378992-134379014 CTCTCAGGCCACTTGGTGCAGGG + Intergenic
968628009 4:1636834-1636856 CTGGCTGGCCTTTGGGTGGAGGG - Intronic
968964894 4:3764872-3764894 CTGGCTGGCCTCTCCCTGCATGG - Intergenic
969447001 4:7250909-7250931 CAGGCTGGCCAGTGGGCGCAGGG + Intronic
979312873 4:119224680-119224702 CTGGCTGGGAACTGGGTACAGGG + Intronic
985424867 4:189820302-189820324 CTGCCTGGCCACTGCATGCAAGG + Intergenic
985424878 4:189820359-189820381 CTGCCTGGCCACTGCATGCAAGG + Intergenic
985424889 4:189820416-189820438 CTGCCTGGCCACTGCATGCAAGG + Intergenic
985424900 4:189820473-189820495 CTGCCTGGCCACTGCATGCAAGG + Intergenic
985424911 4:189820530-189820552 CTGCCTGGCCACTGCATGCAAGG + Intergenic
985424922 4:189820587-189820609 CTGCCTGGCCACTGCATGCAAGG + Intergenic
985424933 4:189820644-189820666 CTGCCTGGCCACTGCATGCAAGG + Intergenic
985517768 5:355724-355746 CTGGATGGCCATCCTGTGCAGGG + Intronic
985994105 5:3587098-3587120 CCTCCTGGCCACTCGGTGCATGG - Intergenic
991525247 5:67549215-67549237 CTGGCTGACCTCTCTGTTCAAGG + Intergenic
999527895 5:152428029-152428051 CTGTCTTGCCACTGGGTGCAGGG - Intronic
1002698397 5:181105275-181105297 CTCGCTGGGCAGTCAGTGCAGGG - Intergenic
1002708501 5:181179633-181179655 CTCGCTGGGCAGTCAGTGCAGGG + Intergenic
1009664337 6:66655642-66655664 CTGGCTGGCCACTCCGAGTGTGG + Intergenic
1014567673 6:122970200-122970222 CTGGCTGGCCACTAAGTAAATGG + Intergenic
1015554946 6:134451685-134451707 CTGCCCAGCCACTTGGTGCATGG + Intergenic
1015913476 6:138191361-138191383 CTGACTGCCCACTCTGTGCCAGG - Intronic
1018762564 6:166904544-166904566 CTGGCTGGCCACTGGCCACATGG + Intronic
1019624480 7:2009040-2009062 CTCCCTGGTCACTCGGTGCCAGG - Intronic
1020703663 7:11514349-11514371 CTGACTGGCTACTCTGTGCCAGG - Intronic
1021596336 7:22320911-22320933 ATGGCTGGTCACTCGATGCAGGG + Intronic
1031279837 7:119784419-119784441 GTGGCTGGCCTCTTGGTGGAAGG - Intergenic
1032319087 7:130868377-130868399 AGGGTTGGCCATTCGGTGCAAGG + Intergenic
1034110069 7:148528255-148528277 GGGGCTGACCACGCGGTGCAAGG - Intergenic
1034437453 7:151069977-151069999 CTGGTGGGCCACTCCGGGCAGGG - Exonic
1034558138 7:151862925-151862947 CTGGTAGGCCTCTGGGTGCAGGG + Intronic
1040562957 8:48540853-48540875 CTGACTGCCCACCAGGTGCAAGG + Intergenic
1044103425 8:88170730-88170752 CTGGCTGGAAACTCAGTGCTAGG - Intronic
1044306745 8:90647380-90647402 CTGGCAGGCAACTGGGTGGAAGG - Intronic
1049202147 8:141345706-141345728 CTGGCAGGCGACTCGGAGCCCGG + Intergenic
1049224081 8:141441386-141441408 CTGGCTGCCCACTGCGTGCCAGG + Intergenic
1049615758 8:143575231-143575253 TGGGCTGGCCTCACGGTGCAGGG + Exonic
1049642357 8:143721426-143721448 CTGGCCGCCCACGCGGAGCACGG + Intronic
1049758126 8:144319848-144319870 CTGGCTGACCACCCGGAGCTCGG + Intronic
1057371796 9:94480230-94480252 CAGGCTGGCCACTGGGTGGGAGG - Intergenic
1058041406 9:100305817-100305839 CTGGCTTCCCATTCTGTGCAAGG - Intronic
1059251290 9:112890068-112890090 ATGGCTGGGCACTCTGGGCAGGG - Exonic
1060700785 9:125747499-125747521 CTGGCTGGCCACTCGGTGCAGGG + Exonic
1060736833 9:126071422-126071444 CTGGCTGGCCCCTAAGTTCAGGG - Intergenic
1186467527 X:9795649-9795671 CTGTTTGGACACTCCGTGCATGG + Intronic
1194340469 X:92699757-92699779 CTGGCTGGCCACTCTGAGTGTGG + Intergenic
1195896386 X:109749597-109749619 CTGGCTGGCCACTCCGAGTGCGG + Intergenic
1197249750 X:124202654-124202676 CTGGCTGACCACTAAGTGTATGG + Intronic
1198504816 X:137290918-137290940 CTGGCTGGCCACTGGGGCCCAGG + Intergenic
1202115787 Y:21468056-21468078 CTGCGTGGCCAATCAGTGCAAGG - Intergenic