ID: 1060701355

View in Genome Browser
Species Human (GRCh38)
Location 9:125751843-125751865
Sequence TAAGATGACCAAAAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060701355 Original CRISPR TAAGATGACCAAAAAGAGGT GGG (reversed) Intronic
901200832 1:7466616-7466638 TAAAATGAGCAAGGAGAGGTGGG + Intronic
902082506 1:13830742-13830764 CAAGATGACCAAGAAGAGAAGGG - Intergenic
903029315 1:20451657-20451679 TAAAATGACCAAAAAGGGGAGGG + Intergenic
905305139 1:37012638-37012660 TCAGATGAGAAAAACGAGGTGGG + Intronic
906835342 1:49077813-49077835 AAAGATGACCAAAGGGAGGAGGG + Intronic
907712242 1:56894527-56894549 TAAGATGATCAATAATAGGTTGG - Intronic
907736679 1:57119979-57120001 TTAGGAGACTAAAAAGAGGTTGG - Intronic
909500167 1:76325899-76325921 AAAGATGAGCAAAAAGAAGTAGG - Intronic
910298815 1:85682318-85682340 TAAGATGAACAAAATGAGGCCGG - Intronic
910560111 1:88581312-88581334 TAAGAAGATCAAAAAGATATTGG + Intergenic
916519664 1:165552335-165552357 AAAGATGAGCAAACTGAGGTTGG - Intronic
916890719 1:169109753-169109775 TAAGAGCACCAAGATGAGGTGGG + Intronic
917807840 1:178629862-178629884 TAAGATAAGTAAAAAGAGATAGG - Intergenic
919093049 1:192997187-192997209 GAAAATCACTAAAAAGAGGTAGG - Intergenic
919357260 1:196538986-196539008 TAACATAACAAAAAAGAGGAGGG - Intronic
919473270 1:198004964-198004986 TAATATTACTAAAAAGAGCTGGG + Intergenic
919808418 1:201394646-201394668 TAAGAAAACCAAGGAGAGGTGGG - Intronic
921544605 1:216459698-216459720 TAAGAGGACCAGGAAGAAGTAGG - Intergenic
923698271 1:236276230-236276252 GGAGATGTCCAAAAAGAAGTTGG + Intronic
924122658 1:240817904-240817926 TAAGAGCACCAAAAAAAGGACGG - Intronic
924299584 1:242624003-242624025 TAAGTTGAATAAAAGGAGGTTGG - Intergenic
1062821385 10:536974-536996 GAAGATGAACAAAAGAAGGTGGG + Intronic
1068873281 10:61968583-61968605 TTAGATTACCAAAAAGAGCACGG - Intronic
1070803499 10:79256888-79256910 TAAGAAAATAAAAAAGAGGTGGG + Intronic
1071584460 10:86806198-86806220 TAACATGACCAATGACAGGTAGG - Intronic
1072956869 10:99894707-99894729 GATGAAGACCAAAAAGAGGGTGG + Intronic
1075487301 10:122834809-122834831 TAACTTGAACAAAAAGAGTTTGG + Exonic
1075601562 10:123773024-123773046 AATGATGACCACAAAGAGGGAGG - Intronic
1076017717 10:127041713-127041735 TAAGATGACTAATAAGAAGTGGG - Intronic
1076447779 10:130529952-130529974 TAAGATGACCATACCGAAGTGGG + Intergenic
1077678079 11:4215049-4215071 GAAGATGACCATGAAGAGCTTGG - Intergenic
1080333769 11:31173773-31173795 AAAGATGTCTAAAAAGATGTGGG - Intronic
1080455634 11:32416330-32416352 TATGATGAATAAGAAGAGGTGGG + Intronic
1080678872 11:34454514-34454536 TAAGATAAGCAGAAAGAAGTGGG + Intronic
1081048091 11:38301418-38301440 TAAGGTGATAAAAATGAGGTAGG - Intergenic
1082204072 11:49410054-49410076 TAAAATGTCCAAAAAAAGGCAGG + Intergenic
1082633869 11:55572846-55572868 CAAGATGACCACAATGATGTGGG - Exonic
1085210145 11:74769081-74769103 TAAGAAGACCAACCAGAGGCTGG + Intronic
1085667473 11:78427650-78427672 TAAGGTGACCAAAAACAGGGTGG - Intergenic
1086651021 11:89290473-89290495 TAAAATGTCCAAAAAAAGGCAGG - Intronic
1086774568 11:90814357-90814379 TAAGATGAACTAAGAAAGGTAGG - Intergenic
1087730363 11:101771911-101771933 TAGAATGACCAAAAACATGTGGG + Intronic
1089389256 11:118088878-118088900 TCAGATGAGAAAACAGAGGTCGG - Intronic
1090312528 11:125754379-125754401 AAAAATCATCAAAAAGAGGTAGG + Intergenic
1091469010 12:710423-710445 TAAAATAACCAAAAAAAGATGGG - Intergenic
1093058399 12:14578104-14578126 CAAGATGAACAATAAGAGGATGG - Intergenic
1094308293 12:29047314-29047336 TCAGCTGACCAAATAGATGTGGG - Intergenic
1095255304 12:40028306-40028328 GAAGAGGAGGAAAAAGAGGTTGG - Exonic
1096232292 12:49903349-49903371 AAAGATGAGCATAAAGTGGTTGG + Intronic
1096997382 12:55847262-55847284 AGAGATGACAAAAAAGAGCTGGG - Intergenic
1098171472 12:67751307-67751329 TCAGAAGACCAAAGAGAGGGGGG + Intergenic
1100158291 12:91827815-91827837 AAAGATGAGCAAGAAGAGTTAGG - Intergenic
1100812161 12:98350006-98350028 TAAGAGCACCAGACAGAGGTAGG - Intergenic
1102799592 12:115719836-115719858 GAAGATGACCATGAAGAAGTTGG - Intergenic
1103892277 12:124248945-124248967 TTAGATGATCAAAAAGATTTAGG - Intronic
1105952011 13:25237516-25237538 TAAGATGAGCAAAAGGATGATGG + Intergenic
1106426236 13:29633085-29633107 TAAAAATACCAAAAAGAGATGGG + Intergenic
1106765557 13:32909851-32909873 TAAGAATACCAAAGAGATGTGGG + Intergenic
1107696251 13:43003028-43003050 TAAGATGAACAAGAACAGATTGG + Intergenic
1107905002 13:45053619-45053641 CATGATGGCCAAAAAGAGTTGGG + Intergenic
1109085596 13:57967120-57967142 TAAGATGACATAAAAGAAGGGGG - Intergenic
1109622020 13:64923380-64923402 TAGGAAGGACAAAAAGAGGTTGG - Intergenic
1110181729 13:72625655-72625677 TAAGATGACAGATAAGAGTTAGG + Intergenic
1110910128 13:80949771-80949793 TAAATTGATCTAAAAGAGGTTGG + Intergenic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1115363713 14:32532964-32532986 AAAGTTGAACAAATAGAGGTTGG + Intronic
1115616000 14:35095541-35095563 TAAGAATGCCAAAAGGAGGTCGG + Intronic
1116657380 14:47669688-47669710 TGAGAAGAGGAAAAAGAGGTTGG + Intronic
1123664360 15:22596502-22596524 TAAGTTAACCAACAAGAGATTGG - Intergenic
1124318194 15:28690938-28690960 TAAGTTAACCAACAAGAGATTGG - Intergenic
1124565239 15:30806529-30806551 TAAGTTAACCAACAAGAGATTGG + Intergenic
1124781219 15:32636540-32636562 TAACATGACCAAAGAGACTTTGG + Exonic
1125423222 15:39525419-39525441 AAAAATGCCCAAACAGAGGTGGG + Intergenic
1125789044 15:42349166-42349188 TAAGAGGAGCACAAAGAGTTAGG - Intronic
1125911875 15:43447399-43447421 TTAGGTGCCCAATAAGAGGTGGG + Exonic
1127123189 15:55788614-55788636 ACAGCTAACCAAAAAGAGGTAGG - Intergenic
1130358084 15:83153515-83153537 CAAGATTACCAAATAGAGCTTGG - Intronic
1134565807 16:15250891-15250913 TAAGCTCAACAAACAGAGGTTGG - Intergenic
1134736688 16:16505807-16505829 TAAGCTCAACAAACAGAGGTTGG + Intergenic
1134930829 16:18206361-18206383 TAAGCTCAACAAACAGAGGTTGG - Intergenic
1137861717 16:51853618-51853640 TAAGGTCAACAAAAAGAGGTTGG + Intergenic
1140605956 16:76537527-76537549 TAAAATGATTTAAAAGAGGTTGG + Intronic
1142627590 17:1202394-1202416 TAAGATGAGTAATAAGAGGTTGG - Intronic
1143007858 17:3848463-3848485 TAAGGTGACCACAAAGAGCAAGG - Intergenic
1143919417 17:10319011-10319033 TGAGATGAACAAGAAGAGGGAGG - Exonic
1144201192 17:12943957-12943979 TAAGATTACCAAAGAGAGGGAGG - Intronic
1145046316 17:19619718-19619740 TGAGATGACTAAACAAAGGTAGG - Intergenic
1145290807 17:21544338-21544360 TTAGATGTTCAAAAAGTGGTGGG - Intronic
1146888853 17:36491727-36491749 TAAGGTGCTCAAAAAGAGGCTGG - Intronic
1152973813 18:193339-193361 TAAAATGTCCAAAATTAGGTGGG - Intronic
1153381652 18:4446839-4446861 TAAGTTTAACAAAAAGAAGTAGG + Intronic
1153392695 18:4580241-4580263 TAAGAACAACAAAATGAGGTAGG + Intergenic
1154152006 18:11913732-11913754 TAAGAAAACAAAAAACAGGTGGG + Intergenic
1155334849 18:24753075-24753097 GAAGATGAGCAGAAATAGGTAGG - Intergenic
1155361537 18:25007844-25007866 TGAGATGCCTAAAATGAGGTAGG - Intergenic
1155444440 18:25896034-25896056 TAAGATCACTTAACAGAGGTGGG - Intergenic
1155549090 18:26946300-26946322 TAACTTGACCAAGAAGAGGGGGG + Intronic
1156594877 18:38537167-38537189 TGAGAAGACCAAAAAGAAGTAGG - Intergenic
1157118609 18:44886456-44886478 TAAGAAGACGAGAAAGAGGAAGG - Intronic
1158285601 18:55878133-55878155 AAAGATGACCAAGATGATGTAGG + Intergenic
1159188015 18:65003749-65003771 TAACATGGCCAAAAAGCTGTTGG - Intergenic
1162253507 19:9467593-9467615 TCAAATGTCCAAAAAGAGATGGG + Exonic
1162946353 19:14046314-14046336 CAAGCAGACCAAAGAGAGGTTGG - Exonic
1163104594 19:15116073-15116095 TAAGAGGACCAAGAGCAGGTGGG + Intronic
1164361048 19:27510922-27510944 CAAGATGTACAAAAAGAGGGTGG - Intergenic
1164682998 19:30148405-30148427 TAAAATGAGCAAAATGAGGGTGG - Intergenic
1165225852 19:34354373-34354395 TAAAAATACCAAAAAGAGGCTGG + Exonic
1166590633 19:43995084-43995106 TAACCTAACCAAAAAGAGGTTGG - Intronic
1168012047 19:53540870-53540892 TGAGATGAACAGAAAGAAGTAGG - Intronic
925436881 2:3846156-3846178 GAAGATGACGAAGAAGAAGTAGG - Intronic
926044745 2:9702367-9702389 GAAGATGGCCAAAAATAGGCAGG - Intergenic
926722769 2:15973889-15973911 TAGGAACACCAAAAAGGGGTGGG - Intergenic
927975453 2:27335139-27335161 GAAGATGAGCAAAAGGAGGGAGG - Intronic
929342056 2:40831859-40831881 AAAGATGAAGCAAAAGAGGTTGG + Intergenic
929635989 2:43521248-43521270 GCAGATGCACAAAAAGAGGTAGG + Intronic
930996234 2:57721893-57721915 TAAGATGACAAAAATGGGATAGG - Intergenic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
933559621 2:83874411-83874433 TTCTATAACCAAAAAGAGGTTGG - Intergenic
934540935 2:95174425-95174447 GAAGATGAGGGAAAAGAGGTAGG - Intronic
935352897 2:102169559-102169581 TCAGAGGACCCAAAATAGGTTGG + Intronic
935429741 2:102962686-102962708 TATGATGACCTAAAAGAAATGGG + Intergenic
936722214 2:115266014-115266036 AAAGATGAAGAAGAAGAGGTAGG + Intronic
937719375 2:125075700-125075722 TAATATGACTAATAATAGGTAGG - Intergenic
937913350 2:127087021-127087043 GAAAATCACCAAAAAGAGGAAGG - Intronic
938649723 2:133370231-133370253 AAATATGACCAGAAAGAGCTTGG + Intronic
938869897 2:135464267-135464289 AAAGAAGAACAAAAGGAGGTAGG - Intronic
939866324 2:147476566-147476588 TAAGATGAGGACAAAGAGGTAGG - Intergenic
940042099 2:149371479-149371501 TTAGTTTACCAAAAAGAGGATGG + Intronic
940410457 2:153357532-153357554 TAAGATGACCAAAAGCAATTTGG + Intergenic
943409208 2:187524917-187524939 AAAGATGACTAAAGAAAGGTGGG + Intronic
943753460 2:191534316-191534338 TAAGATGGCCACAAGGAGGTGGG + Intergenic
943822676 2:192347067-192347089 AAAGATTAAGAAAAAGAGGTTGG - Intergenic
944236771 2:197448195-197448217 TAAAATAACCCAAAAGGGGTTGG - Intergenic
948911252 2:241003875-241003897 AAAGGTGACCAAAAAAATGTTGG + Intronic
1170061160 20:12260705-12260727 TGAGAGGACTAAAAAGAGATGGG - Intergenic
1172678623 20:36694601-36694623 GAATATGACCAAAAAAAGGTGGG - Intronic
1172931266 20:38588041-38588063 TGGGATGAGAAAAAAGAGGTGGG - Intronic
1175275144 20:57763276-57763298 TAAGATGACCAGAAAGTCATGGG + Intergenic
1177235902 21:18389765-18389787 TTTAGTGACCAAAAAGAGGTAGG - Intronic
1177479807 21:21671603-21671625 TAAGATAACCAAATTGGGGTGGG + Intergenic
1178360500 21:31945329-31945351 TAAGATGCCCAGGAAGAGGGGGG - Intronic
1178900520 21:36594429-36594451 TAAGATGACCAAAGATGGGTAGG - Intergenic
1181792755 22:25280989-25281011 AAAGATGACCAATAAAATGTAGG + Intergenic
1181813290 22:25418581-25418603 AAAGATGACCAAGAAAATGTAGG + Intergenic
1184295387 22:43520455-43520477 TAAGATGAGCAATAAGCCGTAGG - Intergenic
949617270 3:5767768-5767790 AAAAAGGACCAAAAAGAGGCTGG - Intergenic
949939036 3:9139813-9139835 TAAGATGACCAGAAGAAGGAAGG + Intronic
952001698 3:28793452-28793474 TAAGATAAGAAGAAAGAGGTAGG + Intergenic
954900166 3:54012385-54012407 TAAGATGACTGAAGAGAGGTTGG - Intergenic
955352366 3:58203265-58203287 TAGGGGGACCAAAAAGAGGATGG - Intronic
955440148 3:58946486-58946508 TAAGATGCCAAAAAAGAAATTGG - Intronic
956534221 3:70257462-70257484 TAAGATGGACAAAGAGAGGAAGG + Intergenic
956826202 3:72998562-72998584 AAATATGACCAAAAAAAGGCTGG - Intronic
958121530 3:89295884-89295906 TGAAATGACAACAAAGAGGTCGG - Intronic
958972782 3:100631232-100631254 TAAAATGACCAAAAAGGTGAAGG - Intronic
959672102 3:108990340-108990362 TGAGATGACGACAGAGAGGTGGG - Intronic
960989012 3:123298515-123298537 GCAGATGACCACAAAGAGATGGG - Intronic
962593018 3:136910340-136910362 TAAAATAACCAAAAGGGGGTAGG - Intronic
963327828 3:143881531-143881553 GAAGCTGAGCAAAAAGAGGCAGG + Intergenic
963741642 3:149087088-149087110 TAAAAATAACAAAAAGAGGTGGG - Intergenic
965356183 3:167675984-167676006 TATGATCACAAAAATGAGGTAGG + Intergenic
965719584 3:171646941-171646963 TAAGGTGACCTAGAAGAAGTGGG - Intronic
966691235 3:182743536-182743558 TAAGTAGACCAGAAAGAGGGTGG - Intergenic
967041315 3:185695679-185695701 TTAGAAGATAAAAAAGAGGTTGG + Intronic
967053483 3:185806266-185806288 TAAGAGCACACAAAAGAGGTGGG + Intronic
970303108 4:14702376-14702398 TAAGATGTTCTCAAAGAGGTCGG - Intergenic
970320113 4:14867205-14867227 TATGTTTATCAAAAAGAGGTTGG - Intergenic
971886169 4:32451210-32451232 TAAGATGAGAAATAAGAGTTGGG - Intergenic
971950292 4:33335938-33335960 TAAGATGTGAAAAATGAGGTTGG + Intergenic
974314016 4:60253851-60253873 CAAAATCACCAAAAACAGGTAGG + Intergenic
974377236 4:61094657-61094679 TAAGATGACCAGAGAGACATTGG - Intergenic
976033523 4:80787815-80787837 TAGCATGACCAAAAATAGATAGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977458053 4:97287309-97287331 TAAGATTACAAAAATGAGGTTGG + Intronic
978751878 4:112259041-112259063 GAAGATGACCAAGAAGTAGTAGG + Intronic
981449257 4:144877462-144877484 TAATAAGAGCAAAAAGAGCTAGG + Intergenic
982606292 4:157520360-157520382 TAAGATAGAGAAAAAGAGGTAGG + Intergenic
983214632 4:164991774-164991796 CAAGGGAACCAAAAAGAGGTTGG - Intergenic
983813747 4:172097142-172097164 TAATACGACCAAAAACAGGAAGG - Intronic
983835587 4:172379588-172379610 TTAGATCACCAAAAAAAGGTGGG + Intronic
984333284 4:178354870-178354892 CAACATGAGCAATAAGAGGTGGG - Intergenic
984334512 4:178372399-178372421 GAAGAGGAGGAAAAAGAGGTTGG - Intergenic
991220118 5:64204574-64204596 TACAATAACCAAAAAAAGGTTGG - Intronic
991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG + Intergenic
992093863 5:73342468-73342490 TAATATGAGCAAAAAGAGTCAGG + Intergenic
992099986 5:73397780-73397802 TAGGATGAGCAAAAAGAAGGTGG - Intergenic
992534709 5:77687866-77687888 TAAGATGACCAAATCCAGGCCGG - Intergenic
993252704 5:85549518-85549540 GAAGAGGACCAAAAAGAAGGTGG + Intergenic
994591188 5:101774736-101774758 TAATATGACCAAAAAGATAAAGG + Intergenic
995401048 5:111742021-111742043 TAACATGTACAAATAGAGGTTGG + Intronic
995899835 5:117052701-117052723 AAAGAGGACCAAAGTGAGGTGGG - Intergenic
996196980 5:120620788-120620810 TGAGATCAGCAAAAAGAGCTGGG - Intronic
997436341 5:133878330-133878352 TCAGATGACCATCAAGTGGTGGG + Intergenic
997801545 5:136867621-136867643 TATGAGGACCAAATAGATGTAGG + Intergenic
998659439 5:144219827-144219849 TAAGATGAATTAAAAGAGCTGGG - Intronic
1000024363 5:157346051-157346073 AAAGATGAAGATAAAGAGGTGGG - Intronic
1000909163 5:166999935-166999957 TAAAATGAGGAAAAGGAGGTGGG + Intergenic
1003475658 6:6479901-6479923 TATCATGTCCACAAAGAGGTAGG + Intergenic
1006900829 6:37499845-37499867 TAACATGACTAAAAAGAAGCGGG - Exonic
1006970010 6:38033183-38033205 TAAGAAGATCAGAAAGGGGTTGG + Intronic
1007317465 6:41000701-41000723 GAAGGTGACCAAAAAGCTGTGGG + Intergenic
1012308010 6:97683481-97683503 TAATATGTCTAAAAAGAGTTAGG + Intergenic
1016416448 6:143839403-143839425 TAAGTTGACCCAAAAGGGGTAGG - Intronic
1018270380 6:162071049-162071071 TCAGATGTGCTAAAAGAGGTTGG + Intronic
1020900013 7:13991691-13991713 CTAGATGAGGAAAAAGAGGTTGG + Intergenic
1021308811 7:19066034-19066056 TAAAATGACCAAAAAGAGTAAGG + Intronic
1022922045 7:35025484-35025506 TAAGATGGTTAAGAAGAGGTGGG + Intronic
1023446621 7:40238353-40238375 TTAGATGGCCAAAATGTGGTTGG + Intronic
1024168769 7:46762671-46762693 CAAGATGAATAAAAAGAGCTGGG + Intergenic
1027487556 7:78780883-78780905 TAAGATGACTGAAAAGTTGTAGG + Intronic
1028769205 7:94597067-94597089 TATGATGACCCATAATAGGTGGG + Intronic
1030728934 7:112961322-112961344 TAAAATGATCAAAAGCAGGTAGG - Intergenic
1031396210 7:121277570-121277592 TAAGATGGGAAAGAAGAGGTGGG - Intronic
1033130767 7:138743739-138743761 TAAGCTGACCCAAAGGAGATGGG + Intronic
1034720588 7:153289198-153289220 CAAGATGAGCAAATAGAAGTTGG + Intergenic
1034815152 7:154165996-154166018 TAAATTGACCAAAAAAAGGCAGG - Intronic
1036054040 8:5230377-5230399 TAACATGACCAAAAGAGGGTAGG - Intergenic
1037763510 8:21757430-21757452 TAATATGACCAAAACGAGATAGG - Intronic
1038913946 8:31998986-31999008 TAAGAAGACCCAAAGCAGGTTGG + Intronic
1041898037 8:62948807-62948829 TTAGATGAAGAAAGAGAGGTTGG - Intronic
1042157519 8:65861928-65861950 TAAGAAGTCCAAAAAGACCTAGG - Intergenic
1044835637 8:96292912-96292934 AAAGAGGACCCAAAAGAGGTTGG + Intronic
1045776158 8:105805597-105805619 AAAGAGGACGAAAAAGAGATTGG - Intergenic
1048840054 8:138557753-138557775 TGAGATCACCAAAGACAGGTTGG + Intergenic
1050329128 9:4527964-4527986 TAAGCTGAGTAACAAGAGGTGGG - Intronic
1051823786 9:21196671-21196693 TAAAATGAAAAAAAAGAGGGAGG - Intergenic
1052223291 9:26054006-26054028 TAAAAAGAGCAAGAAGAGGTAGG + Intergenic
1053477650 9:38393614-38393636 TGAGGAGACCAAAAGGAGGTAGG - Intronic
1056197578 9:84243180-84243202 AAAGATGACCCAAAAGAAGCAGG - Intergenic
1057118380 9:92547125-92547147 TAAGATGATCACAAAGTGTTTGG - Intronic
1060270676 9:122138846-122138868 AGAGATCACCAAGAAGAGGTGGG + Intergenic
1060701355 9:125751843-125751865 TAAGATGACCAAAAAGAGGTGGG - Intronic
1186420330 X:9420429-9420451 TAAGATGACAAATACGAGGGAGG - Intergenic
1187541908 X:20205015-20205037 TAATTTGACCATAAAAAGGTGGG - Intronic
1187655363 X:21465315-21465337 TTAGATGACAAAAAACATGTTGG + Intronic
1187850487 X:23586852-23586874 TAAGTTCCTCAAAAAGAGGTTGG + Intergenic
1188288053 X:28353527-28353549 TAAGATGAGAAAGAAGAGTTGGG + Intergenic
1188313027 X:28640998-28641020 TAAGATGGCCATAAAGATTTTGG + Intronic
1188563878 X:31502437-31502459 AAAGAAGGGCAAAAAGAGGTGGG - Intronic
1189193419 X:39131724-39131746 TAAGATGAGCAAAGAGAGACGGG - Intergenic
1189273586 X:39768901-39768923 GGAGATGACCAAAAAGATGCTGG + Intergenic
1190061863 X:47216806-47216828 TAAAATGATCAGAAGGAGGTGGG - Intergenic
1191143585 X:57140816-57140838 TAGGATTTCCAAAAAGAGGGAGG + Intergenic
1191656469 X:63604186-63604208 TAAGAAAACCAGAAAGATGTGGG + Intergenic
1194006473 X:88499816-88499838 TAAGATGTTCAAAATAAGGTTGG + Intergenic
1194067906 X:89284629-89284651 TAAGCTGACCAGAAACAGGAGGG - Intergenic
1194552336 X:95317656-95317678 TAAGAAGACTAAAAATAGGCCGG + Intergenic
1199551779 X:149068903-149068925 TTTGAGGAACAAAAAGAGGTCGG - Intergenic
1201637411 Y:16139644-16139666 TAAAATGACATTAAAGAGGTAGG + Intergenic
1201675832 Y:16583181-16583203 TTTGATGACCAAAAATAAGTGGG - Intergenic
1201770691 Y:17614622-17614644 TTCTATAACCAAAAAGAGGTTGG + Intergenic
1201830864 Y:18291364-18291386 TTCTATAACCAAAAAGAGGTTGG - Intergenic