ID: 1060702781

View in Genome Browser
Species Human (GRCh38)
Location 9:125773370-125773392
Sequence GTTATCAGCAGACTCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060702781 Original CRISPR GTTATCAGCAGACTCAGAGG TGG (reversed) Intronic
900659420 1:3775241-3775263 CCTAACAGCAGCCTCAGAGGGGG + Intronic
901198438 1:7453338-7453360 ATTATCTGCAGAGTCAGGGGTGG + Intronic
901762201 1:11478763-11478785 GGTATCAGGAAACTCGGAGGCGG + Intergenic
903713380 1:25343696-25343718 ATTTTCAGCAGAGTCAGAGAAGG + Intronic
908875349 1:68668246-68668268 ATTATCTGCACACTCAGAGACGG - Intergenic
909182299 1:72439775-72439797 GATATCAGCATAGTCACAGGGGG - Intergenic
912005343 1:104892256-104892278 TTTATCAGAAGACTCAGTGGTGG + Intergenic
912585256 1:110757975-110757997 GTTTTAAGGAGACTCAGAGGTGG - Intergenic
912938718 1:114026010-114026032 GATAGCAGTAAACTCAGAGGAGG + Intergenic
914681935 1:149944640-149944662 GTTACCAACAGACTCAGCTGGGG + Exonic
915558966 1:156675575-156675597 TTAATCAGCATCCTCAGAGGAGG - Intronic
918121338 1:181543585-181543607 GTTCTCTGCAGACTGAGAAGAGG + Intronic
919145959 1:193635116-193635138 CTTGTCAGAAGACACAGAGGAGG - Intergenic
919835844 1:201572745-201572767 GTCATCACAAGACTCAAAGGAGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921327742 1:214004214-214004236 CTCCTCAGCAGACTCAGAGCTGG - Intronic
1063238136 10:4140670-4140692 GATAGAACCAGACTCAGAGGTGG - Intergenic
1063939813 10:11116547-11116569 GTTATCAGCACACCCAGCTGTGG - Intronic
1064593726 10:16921964-16921986 GTCATCAGCAGACTCAGGTATGG - Intronic
1065657554 10:27967408-27967430 GGTATCAGCAGAGGCATAGGTGG + Intronic
1065890591 10:30118120-30118142 GTTGTCAGGAGACTCTGAAGAGG + Intergenic
1067313102 10:45133728-45133750 GTCATCAGCAGACTCAGGTATGG + Intergenic
1070395418 10:76007774-76007796 TTTATCGTCAGAATCAGAGGAGG + Intronic
1070665915 10:78343241-78343263 GTTATCTGCAGAATCCCAGGTGG + Intergenic
1073788901 10:106919994-106920016 GTCATCAGCAACCTCTGAGGAGG - Intronic
1076058608 10:127395652-127395674 GGTGGCAGCAGACTTAGAGGAGG + Intronic
1076240438 10:128900953-128900975 GTTATCATCAAGCTCTGAGGTGG + Intergenic
1077259315 11:1607367-1607389 GTTTCCAGCAGGCTCACAGGAGG + Intergenic
1079111132 11:17605846-17605868 GTTCTCTGCAGACCCAGATGTGG + Exonic
1079753247 11:24224838-24224860 GATATCAGCAGACTCAGTGTTGG - Intergenic
1081214978 11:40385103-40385125 GTTATCTTCAGAGGCAGAGGCGG + Intronic
1081656065 11:44858348-44858370 GTTATCAGGGGAATTAGAGGAGG + Intronic
1081738291 11:45420488-45420510 GCTCCCAGCAGATTCAGAGGAGG + Intergenic
1084205552 11:67589813-67589835 GAAGTCAGCAGATTCAGAGGAGG - Intergenic
1084224920 11:67710134-67710156 GTGACAAGCAGACTCAGAAGCGG - Intergenic
1084262740 11:67989977-67989999 GTGACAAGCAGACTCAGAAGCGG - Intergenic
1084776021 11:71376166-71376188 GTTCTCAGCAAACTCAGGGAGGG - Intergenic
1084800247 11:71538899-71538921 GTTTCCAGCAGGCTCACAGGAGG - Exonic
1085304356 11:75476766-75476788 GTCATCAGCACAGGCAGAGGAGG + Intronic
1087210662 11:95443624-95443646 GTAATCAAGAGATTCAGAGGAGG - Intergenic
1087474918 11:98622948-98622970 GGCATCAGCAGACACAGAGTGGG - Intergenic
1088115083 11:106304042-106304064 TTTATAAGCAGTCACAGAGGTGG - Intergenic
1088827585 11:113508689-113508711 GTTAACAGCAGACTCTGACCCGG + Intergenic
1092563895 12:9644999-9645021 GGTACCATCAGACTCAGTGGTGG - Intergenic
1094640790 12:32273391-32273413 AGTACCAGCAGACACAGAGGGGG + Intronic
1096664819 12:53157081-53157103 GGTCTCAGCTGTCTCAGAGGAGG - Intergenic
1099783171 12:87226565-87226587 GTTACCAGAGGATTCAGAGGAGG + Intergenic
1100784995 12:98069454-98069476 GTCATGAGCAGCCTCACAGGGGG + Intergenic
1102796337 12:115691953-115691975 ATTAGGAGCAGACACAGAGGGGG - Intergenic
1104193164 12:126503027-126503049 GTTATCAGTACACTCACAAGGGG + Intergenic
1106541291 13:30692223-30692245 GACATCAGGAGACTCAGAAGTGG - Intergenic
1106909455 13:34447973-34447995 GTTCTGAGCTGATTCAGAGGAGG - Intergenic
1108127476 13:47259935-47259957 GTTATAAGCAGACTCTGAAATGG - Intergenic
1109308374 13:60664160-60664182 GTTATGAGCAGAGGAAGAGGGGG - Intergenic
1116831150 14:49721101-49721123 AATATAAACAGACTCAGAGGTGG - Intronic
1117110159 14:52444766-52444788 GTTATCAGAAGCCTCAAAAGTGG + Intronic
1123021447 14:105399576-105399598 GTGATGAGCAGCCTCAGGGGAGG + Intronic
1123986647 15:25652436-25652458 GTTGTCAGCAGAATCAAAGGAGG - Intergenic
1124116423 15:26847492-26847514 GTGATCAGCCAACTCAGGGGAGG - Intronic
1127276744 15:57452716-57452738 CTTCTCTGTAGACTCAGAGGAGG - Intronic
1127633958 15:60851550-60851572 ATTTTCAGCAAACTCAGAGTAGG - Intronic
1130792262 15:87168109-87168131 GTATTCAGCAGCATCAGAGGAGG + Intergenic
1130978155 15:88792911-88792933 TTTATCAGGAGAGTGAGAGGGGG + Intergenic
1133576939 16:7100722-7100744 GTGAACAGAGGACTCAGAGGGGG + Intronic
1134839075 16:17387006-17387028 GAGGTCAACAGACTCAGAGGAGG + Intronic
1136652064 16:31681501-31681523 GTTATCACCAGACTCTGTGTTGG + Intergenic
1138080120 16:54082588-54082610 GCTATCAGCAAACCCTGAGGTGG - Intronic
1138346139 16:56321390-56321412 GTTGGCTGCACACTCAGAGGGGG + Intronic
1139966448 16:70748132-70748154 GTTATCAGCAGGCTCAGGTTTGG - Intronic
1142899296 17:3002497-3002519 GTAATTAGCAGACTGCGAGGAGG + Intronic
1144523333 17:15968942-15968964 GTTATCAGCTGAGGCAGGGGAGG - Intronic
1144917133 17:18733509-18733531 GGAATCACCAGACTCAGAGTAGG + Intronic
1147052033 17:37802515-37802537 TTTATCAGAAGACTGAGTGGAGG + Intergenic
1147884500 17:43675647-43675669 GGGCTCAGGAGACTCAGAGGAGG + Intergenic
1148053114 17:44779011-44779033 GTTAGTAGCAGAGTCAGAGCTGG + Intronic
1151077961 17:71296045-71296067 GTTATCCCCAGTGTCAGAGGTGG - Intergenic
1151271377 17:72998874-72998896 GTTTTCCGCAGCCACAGAGGTGG + Intronic
1152044112 17:77924678-77924700 ATTTTCAGCAGTCTCAGTGGAGG + Intergenic
1152299044 17:79484824-79484846 GTGGACAGCAGGCTCAGAGGAGG - Intronic
1153278175 18:3389602-3389624 ATTTTCTGCAGAATCAGAGGAGG + Intergenic
1159158583 18:64614678-64614700 TTTTTCAGTAGTCTCAGAGGAGG - Intergenic
1160409274 18:78664085-78664107 GGTGTGAGCAGCCTCAGAGGTGG + Intergenic
1163195483 19:15716712-15716734 GCCAACAGCAGCCTCAGAGGTGG - Intergenic
1163524744 19:17813924-17813946 GTTGTCAGCAGACTTAGGAGCGG + Intergenic
1163547114 19:17947264-17947286 GGTCTCAGAAGAGTCAGAGGTGG - Intergenic
1167300021 19:48672805-48672827 GCTCCCAGCAGACTCATAGGAGG + Intronic
925223462 2:2161713-2161735 GCTCCCAGCAGCCTCAGAGGTGG + Intronic
927882136 2:26696323-26696345 GTAAGCAGCAGAGTCAGAGTGGG + Intronic
933235302 2:79858031-79858053 GTCATCTGCAAACTCGGAGGAGG - Exonic
934691628 2:96365134-96365156 CTCATCAGTAGACTCAGAGAAGG - Intronic
935396018 2:102610149-102610171 GTTTTCAGCTGCCTCAGTGGAGG - Intergenic
936125018 2:109781624-109781646 ATTATGAGCAGACGCTGAGGTGG + Intergenic
936219675 2:110589844-110589866 ATTATGAGCAGACGCTGAGGTGG - Intergenic
938589129 2:132720317-132720339 GTTGTTAGCAGAGTCAGTGGGGG - Intronic
940074264 2:149722892-149722914 GTCACCAGAAGACCCAGAGGAGG - Intergenic
944146793 2:196514769-196514791 GCTCTCAGGAGACTCAGAGTGGG - Intronic
944830865 2:203533554-203533576 GATTTCAGCAGATTCAGATGGGG - Intronic
946208248 2:218126421-218126443 GTTCTCAGGGGCCTCAGAGGAGG - Intronic
947518156 2:230824706-230824728 GTTTTCAGCAGGCTCTGAGCTGG + Intergenic
1170341260 20:15329871-15329893 GAAAACAGCAGACACAGAGGAGG + Intronic
1170500298 20:16968861-16968883 GTTATCAGCAGAATAAGAAGAGG - Intergenic
1171286898 20:23947346-23947368 CTTCTCAGAAGACACAGAGGAGG - Intergenic
1174842622 20:53914507-53914529 TTTATCAACAGTCTCAGAAGGGG + Intergenic
1176942696 21:14943027-14943049 TGTATCAGCAAACTCACAGGGGG + Intergenic
1179062306 21:37990233-37990255 GTTCTCAGTGGCCTCAGAGGAGG + Intronic
1183402677 22:37613875-37613897 GTTCTCAGCAGAATCAGAGGAGG + Intronic
952882882 3:37996251-37996273 GTTAGCAGCACAGTGAGAGGTGG + Intronic
954994012 3:54865491-54865513 GGTTGCAACAGACTCAGAGGAGG - Intronic
956213147 3:66822492-66822514 GTTATCAGCTGTCTCCTAGGTGG + Intergenic
962163430 3:133023708-133023730 GCTATCAACAGACCCAGTGGTGG - Intergenic
969021249 4:4141892-4141914 GTGAAAAGCAGACTCAGAAGCGG - Intergenic
969706935 4:8817137-8817159 GATAAGAGCAGACTCAGTGGAGG - Intergenic
969732616 4:8965524-8965546 GTGAAAAGCAGACTCAGAAGCGG + Intergenic
969792198 4:9499607-9499629 GTGAAAAGCAGACTCAGAAGCGG + Intergenic
970849901 4:20589449-20589471 CTTAGCAGCAGACTCAGAATTGG + Intronic
981541148 4:145847392-145847414 GTTGTCATCAAAGTCAGAGGCGG - Intronic
982181505 4:152752090-152752112 GTTCTCAGGAGACTCAAAGTGGG - Intronic
984162520 4:176271220-176271242 GTAATTAGCAGACTCAGAGAGGG - Intronic
984432611 4:179667440-179667462 GTTTTCTGGAGACCCAGAGGTGG + Intergenic
987721651 5:21641994-21642016 GTGATGGACAGACTCAGAGGTGG - Intergenic
988696309 5:33625983-33626005 GCCTTCAGCAGAATCAGAGGTGG + Intronic
989813707 5:45710214-45710236 TTTATCAGCAGCCTGACAGGTGG + Intergenic
1000918472 5:167110184-167110206 TTTATCACCAGATTCAGTGGTGG - Intergenic
1001939999 5:175733612-175733634 CTTATAAGCAGAGTCAGAGAAGG - Intergenic
1003315300 6:5006259-5006281 GTTATCAGCAGCCAGAGAGGAGG - Intergenic
1005823860 6:29620367-29620389 GTAATAAGCAGACACATAGGTGG + Intronic
1008142332 6:47846269-47846291 TTTATCACCAGACCCAGTGGAGG + Intergenic
1013494760 6:110687587-110687609 GTTATGAGAAAACACAGAGGGGG + Intronic
1013726072 6:113097242-113097264 GTTATCAGCAGAGGCTGAGTGGG + Intergenic
1015840544 6:137472099-137472121 GTTATCAGCGAAGTCAGAGCTGG + Intergenic
1018606956 6:165607913-165607935 GTTCTCTGCAAACTCAGCGGAGG - Intronic
1019079824 6:169422713-169422735 GTGCTCAGTAAACTCAGAGGGGG + Intergenic
1019847950 7:3525327-3525349 TTTATCAGCAGACACAGATGGGG + Intronic
1023302445 7:38788023-38788045 GCTATCAGCAGTCACAGAGTTGG + Intronic
1023785487 7:43703997-43704019 GTTACCAGCAGACTTACAAGAGG - Intronic
1031987796 7:128174602-128174624 TTTGTCGGCAGACTGAGAGGTGG - Intergenic
1032440995 7:131943124-131943146 GTTATCTGCAGATTAAGAGTAGG - Intergenic
1033016267 7:137674700-137674722 AACATGAGCAGACTCAGAGGTGG - Intronic
1033635571 7:143208764-143208786 GGTACCAGGAGACTGAGAGGTGG - Intergenic
1036094210 8:5705364-5705386 GTTATCACTTGATTCAGAGGTGG + Intergenic
1040353936 8:46597238-46597260 GTGATCATCAGGCTCAGAGAAGG + Intergenic
1042957065 8:74262213-74262235 GTTAACAGCAAACTCAGAGTGGG - Intronic
1051328704 9:16000511-16000533 GTCATCAGCAGACTGAGGTGGGG + Intronic
1051707796 9:19898888-19898910 GTTATTAGGTGGCTCAGAGGAGG + Intergenic
1053180289 9:35962458-35962480 GGAATCAGGAGACTCAGAAGCGG - Intergenic
1053442915 9:38130678-38130700 GTCATCTCCATACTCAGAGGTGG + Intergenic
1055112925 9:72577219-72577241 GTTATGAGCAGCCCAAGAGGAGG - Intronic
1060702781 9:125773370-125773392 GTTATCAGCAGACTCAGAGGTGG - Intronic
1061318491 9:129813002-129813024 GTTCTCAGCATCCTCAGAAGGGG + Exonic
1186515630 X:10164501-10164523 GTCAGGAGCAGAGTCAGAGGTGG + Intronic
1186810866 X:13187264-13187286 TCTATCAGCAGAAGCAGAGGAGG + Intergenic
1189023097 X:37362826-37362848 GTCCTCAGCAGACTGGGAGGGGG + Intronic
1189398748 X:40646354-40646376 GTTATCAGCAGGCACAGGGTGGG - Intronic
1191605529 X:63058071-63058093 GTCAGCAGCAGCCTCAGAAGAGG + Intergenic
1192587361 X:72329586-72329608 CTGATCAGCAGACTGGGAGGTGG - Exonic
1192759399 X:74079981-74080003 TTTATCAGCAGACTCAAACAGGG + Intergenic
1192867809 X:75154290-75154312 GTTATTAGGAATCTCAGAGGAGG - Intronic
1198091747 X:133337763-133337785 GTGATCAGGAGAGACAGAGGAGG + Intronic