ID: 1060703178

View in Genome Browser
Species Human (GRCh38)
Location 9:125777444-125777466
Sequence GGAGAATTGCTTGAACCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25433
Summary {0: 609, 1: 2017, 2: 4966, 3: 8081, 4: 9760}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060703178_1060703189 29 Left 1060703178 9:125777444-125777466 CCCCTGGGTTCAAGCAATTCTCC 0: 609
1: 2017
2: 4966
3: 8081
4: 9760
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703178_1060703184 2 Left 1060703178 9:125777444-125777466 CCCCTGGGTTCAAGCAATTCTCC 0: 609
1: 2017
2: 4966
3: 8081
4: 9760
Right 1060703184 9:125777469-125777491 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
1060703178_1060703182 1 Left 1060703178 9:125777444-125777466 CCCCTGGGTTCAAGCAATTCTCC 0: 609
1: 2017
2: 4966
3: 8081
4: 9760
Right 1060703182 9:125777468-125777490 GCCTCAGCCTCCCAAGTAGCTGG 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
1060703178_1060703186 10 Left 1060703178 9:125777444-125777466 CCCCTGGGTTCAAGCAATTCTCC 0: 609
1: 2017
2: 4966
3: 8081
4: 9760
Right 1060703186 9:125777477-125777499 TCCCAAGTAGCTGGGACTACAGG 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060703178 Original CRISPR GGAGAATTGCTTGAACCCAG GGG (reversed) Intronic
Too many off-targets to display for this crispr