ID: 1060703179

View in Genome Browser
Species Human (GRCh38)
Location 9:125777445-125777467
Sequence AGGAGAATTGCTTGAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19257
Summary {0: 474, 1: 1625, 2: 3673, 3: 6354, 4: 7131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060703179_1060703184 1 Left 1060703179 9:125777445-125777467 CCCTGGGTTCAAGCAATTCTCCT 0: 474
1: 1625
2: 3673
3: 6354
4: 7131
Right 1060703184 9:125777469-125777491 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
1060703179_1060703182 0 Left 1060703179 9:125777445-125777467 CCCTGGGTTCAAGCAATTCTCCT 0: 474
1: 1625
2: 3673
3: 6354
4: 7131
Right 1060703182 9:125777468-125777490 GCCTCAGCCTCCCAAGTAGCTGG 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
1060703179_1060703186 9 Left 1060703179 9:125777445-125777467 CCCTGGGTTCAAGCAATTCTCCT 0: 474
1: 1625
2: 3673
3: 6354
4: 7131
Right 1060703186 9:125777477-125777499 TCCCAAGTAGCTGGGACTACAGG 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
1060703179_1060703189 28 Left 1060703179 9:125777445-125777467 CCCTGGGTTCAAGCAATTCTCCT 0: 474
1: 1625
2: 3673
3: 6354
4: 7131
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060703179 Original CRISPR AGGAGAATTGCTTGAACCCA GGG (reversed) Intronic
Too many off-targets to display for this crispr