ID: 1060703181

View in Genome Browser
Species Human (GRCh38)
Location 9:125777465-125777487
Sequence GCTACTTGGGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 965584
Summary {0: 74529, 1: 175606, 2: 216051, 3: 220891, 4: 278507}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060703181_1060703189 8 Left 1060703181 9:125777465-125777487 CCTGCCTCAGCCTCCCAAGTAGC 0: 74529
1: 175606
2: 216051
3: 220891
4: 278507
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060703181 Original CRISPR GCTACTTGGGAGGCTGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr