ID: 1060703183

View in Genome Browser
Species Human (GRCh38)
Location 9:125777469-125777491
Sequence CCCAGCTACTTGGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1092628
Summary {0: 89011, 1: 200457, 2: 243521, 3: 257984, 4: 301655}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060703183_1060703189 4 Left 1060703183 9:125777469-125777491 CCTCAGCCTCCCAAGTAGCTGGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060703183 Original CRISPR CCCAGCTACTTGGGAGGCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr