ID: 1060703185

View in Genome Browser
Species Human (GRCh38)
Location 9:125777475-125777497
Sequence TGTAGTCCCAGCTACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1097396
Summary {0: 41507, 1: 154089, 2: 219927, 3: 224998, 4: 456875}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060703185_1060703189 -2 Left 1060703185 9:125777475-125777497 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060703185 Original CRISPR TGTAGTCCCAGCTACTTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr