ID: 1060703187

View in Genome Browser
Species Human (GRCh38)
Location 9:125777478-125777500
Sequence ACCTGTAGTCCCAGCTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842850
Summary {0: 13442, 1: 93053, 2: 234640, 3: 257908, 4: 243807}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060703187_1060703189 -5 Left 1060703187 9:125777478-125777500 CCCAAGTAGCTGGGACTACAGGT 0: 13442
1: 93053
2: 234640
3: 257908
4: 243807
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060703187 Original CRISPR ACCTGTAGTCCCAGCTACTT GGG (reversed) Intronic
Too many off-targets to display for this crispr