ID: 1060703188

View in Genome Browser
Species Human (GRCh38)
Location 9:125777479-125777501
Sequence CACCTGTAGTCCCAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580448
Summary {0: 27099, 1: 99923, 2: 128146, 3: 148395, 4: 176885}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060703188_1060703192 30 Left 1060703188 9:125777479-125777501 CCAAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1060703192 9:125777532-125777554 TTTTTGTATTTTAGTAGAGACGG 0: 5223
1: 6023
2: 7527
3: 27046
4: 265462
1060703188_1060703189 -6 Left 1060703188 9:125777479-125777501 CCAAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060703188 Original CRISPR CACCTGTAGTCCCAGCTACT TGG (reversed) Intronic
Too many off-targets to display for this crispr