ID: 1060703189

View in Genome Browser
Species Human (GRCh38)
Location 9:125777496-125777518
Sequence CAGGTGCAAGCTGCCGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060703177_1060703189 30 Left 1060703177 9:125777443-125777465 CCCCCTGGGTTCAAGCAATTCTC 0: 19769
1: 63950
2: 138151
3: 186778
4: 156944
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703181_1060703189 8 Left 1060703181 9:125777465-125777487 CCTGCCTCAGCCTCCCAAGTAGC 0: 74529
1: 175606
2: 216051
3: 220891
4: 278507
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703178_1060703189 29 Left 1060703178 9:125777444-125777466 CCCCTGGGTTCAAGCAATTCTCC 0: 609
1: 2017
2: 4966
3: 8081
4: 9760
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703180_1060703189 27 Left 1060703180 9:125777446-125777468 CCTGGGTTCAAGCAATTCTCCTG 0: 30582
1: 98870
2: 203067
3: 190538
4: 143094
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703187_1060703189 -5 Left 1060703187 9:125777478-125777500 CCCAAGTAGCTGGGACTACAGGT 0: 13442
1: 93053
2: 234640
3: 257908
4: 243807
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703185_1060703189 -2 Left 1060703185 9:125777475-125777497 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703183_1060703189 4 Left 1060703183 9:125777469-125777491 CCTCAGCCTCCCAAGTAGCTGGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703188_1060703189 -6 Left 1060703188 9:125777479-125777501 CCAAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data
1060703179_1060703189 28 Left 1060703179 9:125777445-125777467 CCCTGGGTTCAAGCAATTCTCCT 0: 474
1: 1625
2: 3673
3: 6354
4: 7131
Right 1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060703189 Original CRISPR CAGGTGCAAGCTGCCGTGCC TGG Intronic
No off target data available for this crispr