ID: 1060705094

View in Genome Browser
Species Human (GRCh38)
Location 9:125791552-125791574
Sequence CAGGAGGAAGAGAGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4665
Summary {0: 1, 1: 21, 2: 183, 3: 761, 4: 3699}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060705094_1060705102 1 Left 1060705094 9:125791552-125791574 CCCCCTGCCCTCTCTTCCTCCTG 0: 1
1: 21
2: 183
3: 761
4: 3699
Right 1060705102 9:125791576-125791598 GCTCTCTCTTCCTCCTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060705094 Original CRISPR CAGGAGGAAGAGAGGGCAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr