ID: 1060708107

View in Genome Browser
Species Human (GRCh38)
Location 9:125825874-125825896
Sequence CAAAGCTACTACATTAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060708107_1060708109 0 Left 1060708107 9:125825874-125825896 CCAAGTTTAATGTAGTAGCTTTG 0: 1
1: 0
2: 0
3: 15
4: 246
Right 1060708109 9:125825897-125825919 TTTAGTTTAGGAATCTTATTTGG No data
1060708107_1060708111 22 Left 1060708107 9:125825874-125825896 CCAAGTTTAATGTAGTAGCTTTG 0: 1
1: 0
2: 0
3: 15
4: 246
Right 1060708111 9:125825919-125825941 GGAACTTGCCTAGAATGTCCTGG No data
1060708107_1060708112 26 Left 1060708107 9:125825874-125825896 CCAAGTTTAATGTAGTAGCTTTG 0: 1
1: 0
2: 0
3: 15
4: 246
Right 1060708112 9:125825923-125825945 CTTGCCTAGAATGTCCTGGAAGG No data
1060708107_1060708110 1 Left 1060708107 9:125825874-125825896 CCAAGTTTAATGTAGTAGCTTTG 0: 1
1: 0
2: 0
3: 15
4: 246
Right 1060708110 9:125825898-125825920 TTAGTTTAGGAATCTTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060708107 Original CRISPR CAAAGCTACTACATTAAACT TGG (reversed) Intronic
903104202 1:21060805-21060827 CAAAGCTACTGCAATCATCTTGG + Intronic
906808158 1:48800212-48800234 CAACCCTCCTACATTAAACCAGG - Intronic
908454708 1:64291949-64291971 TAAAGATACTACATGATACTTGG + Intergenic
908658437 1:66412909-66412931 CTAAACTCCTACATTAAACCAGG + Intergenic
910206125 1:84750620-84750642 GAAAGCTCCTAATTTAAACTTGG - Intergenic
910237967 1:85055104-85055126 CAAAGATACTACCTGAGACTGGG - Intronic
910921426 1:92351843-92351865 CAAAGCTTTTATATTAAATTTGG - Intronic
911426098 1:97714706-97714728 TGAAGCTACTACATTGAAATAGG - Intronic
915058537 1:153159626-153159648 TAAAGATACTACCTGAAACTGGG + Intergenic
917323161 1:173804860-173804882 CAAAGCTATGATATTAACCTTGG - Intronic
917801783 1:178578137-178578159 TAAAGGTACTAAATTGAACTAGG - Intergenic
919323734 1:196079149-196079171 CAAAGATAGTAAATTAAATTTGG + Intergenic
924906717 1:248462302-248462324 CAATGCTCCTAGATTAAACCAGG + Intergenic
1065467963 10:26045547-26045569 CAAAGCTGCTACATGAACCAAGG - Intronic
1067200107 10:44161395-44161417 CAAAGCTGCTTCAGTAAACAAGG + Intergenic
1068012171 10:51465593-51465615 CAAAGCCATTGCATTAATCTAGG + Intronic
1071045724 10:81373753-81373775 CAACCCTCCTAGATTAAACTGGG - Intergenic
1071742286 10:88373427-88373449 CAAAGCAAATAAACTAAACTTGG + Intronic
1072259157 10:93651305-93651327 TAAAGCTACTACCTGAGACTGGG + Intronic
1072559834 10:96561715-96561737 CCCAGCTACAACAGTAAACTTGG + Intronic
1073568359 10:104555013-104555035 CAAACCTTCTACCTTTAACTTGG - Intergenic
1073747018 10:106480681-106480703 CAGAGCTACTACAGTAAATGAGG - Intergenic
1075288877 10:121211153-121211175 CAAAGCTAGGATATTAACCTAGG - Intergenic
1075349054 10:121707831-121707853 CAAAGTTGATATATTAAACTTGG - Intergenic
1076182386 10:128420379-128420401 TAAAGATACTACATGAGACTGGG + Intergenic
1078741710 11:14072860-14072882 CAAAGATATCTCATTAAACTTGG + Intronic
1079174821 11:18129465-18129487 CAAACCTCCTAGATTAAACTAGG + Intronic
1079178384 11:18165451-18165473 CAAACCTCCTAGATTAAACTAGG + Intronic
1079465402 11:20724845-20724867 CAAAGATACTACCTGACACTGGG + Intronic
1080127203 11:28750419-28750441 CAAAGATTTTAAATTAAACTAGG - Intergenic
1080340405 11:31256813-31256835 CAAAGCTACTAAATGCAGCTGGG + Intronic
1080486228 11:32709916-32709938 CAAACCTGCTAGATTAAACCAGG - Intronic
1081156676 11:39701799-39701821 CAAATCTAAAACATTAAAATAGG + Intergenic
1082193801 11:49277922-49277944 CAAAGATACTACCTGAGACTTGG + Intergenic
1083380751 11:62266547-62266569 CAAAGCAAAAACATTTAACTTGG - Intergenic
1083497081 11:63064956-63064978 CAACCCTCCTACATTAAACAAGG - Intergenic
1083977165 11:66132386-66132408 TAAAGATACTACATGAGACTGGG - Intronic
1085452300 11:76641968-76641990 CAAAGCTACTACATTCAAGAAGG - Intergenic
1086408366 11:86519123-86519145 CATAGCTACTACACAAAAATTGG - Intronic
1086672341 11:89563136-89563158 CAAAGATACTACCTGAGACTTGG - Intergenic
1087694244 11:101357604-101357626 TAAAGATACTACATGAGACTGGG + Intergenic
1087700064 11:101426544-101426566 CACAGCTAACACATTAAACAGGG - Intergenic
1089428212 11:118398651-118398673 CAAAGCCAATACACAAAACTAGG - Exonic
1093754930 12:22841887-22841909 AAAGGCTACTACAATAATCTAGG - Intergenic
1095850832 12:46802983-46803005 CAAAGTTACTAAAAGAAACTAGG - Intronic
1098191699 12:67956043-67956065 GAAAGCTAATAAATTAAACACGG + Intergenic
1099400334 12:82195410-82195432 CAACCCTCCTATATTAAACTGGG + Intergenic
1099957798 12:89368152-89368174 AAAAGCTACCATATCAAACTGGG + Intergenic
1100234409 12:92644691-92644713 CAAAACTAGTATATTAAACAAGG - Intergenic
1100421564 12:94439458-94439480 CAACCCTCCTAGATTAAACTAGG + Intronic
1101526241 12:105533984-105534006 TAAAGATACTACCTGAAACTGGG + Intergenic
1108831923 13:54490024-54490046 CAACTCTCCTAGATTAAACTAGG + Intergenic
1109266525 13:60206980-60207002 CATTGTTACTACATCAAACTAGG - Intergenic
1109587586 13:64427432-64427454 CATATCTACTATATTAAATTTGG + Intergenic
1110632152 13:77721361-77721383 CAAAGATACTACCTGAGACTGGG - Intronic
1110958018 13:81581535-81581557 CAAAGATACTACCTGAGACTGGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112630393 13:101155217-101155239 CAAAACTACAAAATTAACCTTGG + Intronic
1113035812 13:106047487-106047509 CAAAGATACTACCTGAGACTGGG - Intergenic
1114594041 14:23895905-23895927 CAAAGCTACCACACAAAAGTTGG + Intergenic
1115102413 14:29718455-29718477 TAAAGATACTACATGAGACTGGG - Intronic
1116759170 14:48989652-48989674 CAAAGCTAATTCATGAAAGTAGG - Intergenic
1118203490 14:63699760-63699782 CATATCTACTACATTTAACATGG + Intronic
1118470007 14:66066872-66066894 CTAAGCTACGAAATGAAACTTGG - Intergenic
1120324146 14:83004418-83004440 CAAAGATACTACCCAAAACTTGG + Intergenic
1124965664 15:34431505-34431527 CAAACCTACTACAACACACTAGG + Intronic
1124982291 15:34577651-34577673 CAAACCTACTACAACACACTAGG + Intronic
1126184396 15:45817230-45817252 CAACCCTCCTACATTAAACCTGG - Intergenic
1126409735 15:48360862-48360884 AAAAGCTGGGACATTAAACTCGG - Intergenic
1126958289 15:53959725-53959747 CCAAGCTACAATATTAAAGTGGG + Intergenic
1130168808 15:81490930-81490952 CAAAGCTACTACCTGAGACTGGG + Intergenic
1133452200 16:5913079-5913101 CATAGCTACTACATGCAGCTTGG - Intergenic
1135350489 16:21725190-21725212 CAAAGCAACTACAGTAAGCCAGG - Intronic
1138119118 16:54384060-54384082 CAAAGCTACTACCTGAGACTGGG - Intergenic
1148604003 17:48915053-48915075 TAAAGCTAATACAGTCAACTAGG - Intronic
1149013840 17:51885690-51885712 CAAATCTTCTCCATTCAACTGGG + Intronic
1149331356 17:55586073-55586095 TAAAGATACTACCTGAAACTGGG + Intergenic
1149811239 17:59674922-59674944 CAAAGCTACTAAATAACACATGG + Intronic
1150583443 17:66496538-66496560 GAAAGCTATTACAATAAATTTGG - Intronic
1153110256 18:1578216-1578238 CAAAGCTTCTGCATTAAAACTGG - Intergenic
1153176043 18:2374480-2374502 CAACTCTCCTACATTAAACCAGG - Intergenic
1153880981 18:9421594-9421616 CAAAATTACTAAATTAAAATTGG + Intergenic
1156766221 18:40659817-40659839 CAAATCTACTACATTACCATCGG - Intergenic
1156868102 18:41911616-41911638 AAAAGCTACCACTCTAAACTTGG - Intergenic
1157536141 18:48458990-48459012 CAGAGCTATTACATAAAACTGGG + Intergenic
1157837655 18:50921852-50921874 CAAAGGTACTAAGTTAATCTGGG - Intronic
1159401928 18:67949588-67949610 TAAAGCTACTACCTGTAACTGGG + Intergenic
1160225945 18:77010736-77010758 CAAAGATAATACATTAAGTTAGG - Intronic
1164096653 19:22016193-22016215 CAAACCTCCTAGATTAAACCCGG - Intergenic
1167683493 19:50940833-50940855 CAAAGATACTACCTAAGACTGGG - Intergenic
926235497 2:11040127-11040149 CTCAGCCACTACTTTAAACTGGG + Intergenic
926527102 2:13994303-13994325 CAAACCTCCTATATTAAACCAGG - Intergenic
928479872 2:31671872-31671894 CAACCCTCCTACATTAAATTAGG - Intergenic
928783177 2:34849565-34849587 CCAAACCACTACAGTAAACTGGG - Intergenic
929914586 2:46123784-46123806 CATAGATACAACATAAAACTTGG - Intronic
930527813 2:52552537-52552559 CAAAACTACTACAAAAAATTGGG + Intergenic
931009215 2:57888737-57888759 CAAAGAGACCACATTAAACCAGG + Intergenic
932956366 2:76356264-76356286 TAAAGATACTACATGAGACTAGG - Intergenic
935393476 2:102580160-102580182 CAAAGCTACTATATTTAAAATGG + Intergenic
937506027 2:122537317-122537339 CAAAGCTAAGACCTGAAACTAGG - Intergenic
940684868 2:156834892-156834914 CTGAGCTTCTACATTAAGCTTGG - Intergenic
941073190 2:160977856-160977878 CAAAGCTAGTAATTTACACTTGG + Intergenic
941404340 2:165070128-165070150 CAAAGCCACTACACTAGGCTAGG - Intergenic
941697463 2:168568975-168568997 CATAGCTACTACAATAAATACGG + Intronic
942481401 2:176392361-176392383 CAAAGCCATTCCATTTAACTTGG - Intergenic
943044888 2:182848657-182848679 GAAATCAACTATATTAAACTAGG + Intronic
944058771 2:195549310-195549332 CAAAGCTACTACATTCATTCAGG + Intergenic
945366265 2:208957637-208957659 CAAAGATACTACTTGAGACTGGG - Intergenic
945387279 2:209217741-209217763 CAACCCTCCTAGATTAAACTAGG + Intergenic
945553275 2:211248015-211248037 CAAAAGTCCTACATAAAACTTGG + Intergenic
945738959 2:213637655-213637677 CAACCCTCCTAGATTAAACTAGG - Intronic
946786633 2:223252043-223252065 CAAAGCTAAATCATTAAGCTAGG - Intergenic
947756830 2:232572233-232572255 CAAATCTACCACCTAAAACTAGG - Intronic
1169945205 20:10980744-10980766 CTAAGCTACTAGAATACACTGGG + Intergenic
1171978723 20:31611819-31611841 TAAAGCTTCTACAATATACTAGG + Intergenic
1174690841 20:52502897-52502919 CAAAGGCACCATATTAAACTAGG - Intergenic
1174814816 20:53677712-53677734 TAAAGCTTCTACATAAAAATTGG + Intergenic
1174981665 20:55402428-55402450 TAAAGATACTACCTTAGACTGGG + Intergenic
1179043412 21:37824827-37824849 TAAAGATACTACCTGAAACTGGG - Intronic
1181969938 22:26682237-26682259 CAAAGCTAGTTCATAAAACGCGG + Intergenic
949378255 3:3414335-3414357 CAAGCCTCCTAGATTAAACTAGG + Intergenic
949651830 3:6168611-6168633 CAAAGATACTACCTGAGACTGGG - Intergenic
950820018 3:15746910-15746932 CAACCCTCCTAGATTAAACTAGG - Intronic
951645134 3:24881261-24881283 TAAAGATACTACCTGAAACTGGG - Intergenic
951748331 3:26004776-26004798 AAAGGTTACAACATTAAACTTGG - Intergenic
952144200 3:30514044-30514066 CAATGCTAAGACATTAAACAAGG + Intergenic
952703540 3:36351976-36351998 CAACCCTCCTAGATTAAACTGGG + Intergenic
952739462 3:36721620-36721642 CAAATCTACTACCTTGAAATTGG - Exonic
953295511 3:41711416-41711438 AAAAGCTCCTACAGCAAACTGGG + Intronic
955094533 3:55783996-55784018 CTAAGATATTACCTTAAACTAGG + Intronic
955636122 3:61031560-61031582 CAAAGCTTTGACATTTAACTGGG - Intronic
956916078 3:73872373-73872395 TAAAGATACTACCTGAAACTGGG - Intergenic
957542087 3:81585188-81585210 CATAGCTGTGACATTAAACTTGG - Intronic
957585319 3:82125110-82125132 CAAGGCTACCAAATTAAATTGGG - Intergenic
959009469 3:101058270-101058292 CAACCCTCCTACATTTAACTAGG - Intergenic
959230917 3:103649849-103649871 CAAAGCTCCAAGATTTAACTAGG + Intergenic
959730933 3:109601416-109601438 CAACCCTCCTAGATTAAACTAGG - Intergenic
959956642 3:112246509-112246531 CAAAGCCAATAAATAAAACTAGG + Intronic
960024047 3:112988282-112988304 GAAAGCTACTGCAATAATCTAGG + Intergenic
960416977 3:117396927-117396949 CAAAGCTATCACAATCAACTGGG + Intergenic
960485160 3:118242685-118242707 GAAAGCTAGTACATTAAATCAGG + Intergenic
960523617 3:118683656-118683678 CAAAGATACTACAATAAATATGG + Intergenic
960797037 3:121498393-121498415 GAAAGTGACTACAATAAACTGGG + Intronic
962503100 3:136015527-136015549 CAACCCTCCTAGATTAAACTAGG - Intronic
964299660 3:155274382-155274404 CAACCCTTCTAGATTAAACTAGG + Intergenic
964342553 3:155723034-155723056 CAATCCTCCTAGATTAAACTAGG - Intronic
965849573 3:173007740-173007762 CAAAGCTATTGAATTGAACTTGG + Intronic
967495484 3:190139769-190139791 CAAATTTACAAGATTAAACTGGG + Intergenic
967557989 3:190881569-190881591 CAAAGCTACTACAATGTATTTGG + Intronic
967747497 3:193074257-193074279 TAAAGATACTACCTAAAACTGGG + Intergenic
968316900 3:197732606-197732628 TAAAACTACTACACTACACTGGG - Intronic
971101291 4:23468611-23468633 CTAAGCTGCAACATTAAATTCGG + Intergenic
971619555 4:28838240-28838262 CATATCTACTGCAATAAACTTGG + Intergenic
972211770 4:36847062-36847084 TAAAGTTACTACATTCAACATGG - Intergenic
973655236 4:53040562-53040584 CAAAGTATCTACATTAAACATGG - Intronic
973810157 4:54561821-54561843 CACAGCAACTACAGTAAACCAGG - Intergenic
974014856 4:56639594-56639616 CAAAGGTACTACCTGAGACTGGG - Intergenic
975038470 4:69713259-69713281 TAAAGATACTACATGAGACTGGG - Intergenic
976884961 4:89970610-89970632 CATTGCTACTGAATTAAACTAGG + Intergenic
977267095 4:94868069-94868091 CAAAACTTCTAGATTAGACTGGG - Intronic
977516282 4:98024204-98024226 TAAAGATACTACATGAAACTAGG - Intronic
977823508 4:101503176-101503198 TAAAGATACTACCTGAAACTGGG + Intronic
979019715 4:115481076-115481098 TAAAGATACTACCTGAAACTGGG + Intergenic
979951184 4:126896257-126896279 TAAAGATACTACATGAGACTGGG + Intergenic
980480695 4:133384008-133384030 CTAAACTACTACATTATACTGGG + Intergenic
980644840 4:135630077-135630099 CAACCCTCCTAGATTAAACTAGG - Intergenic
981277037 4:142912795-142912817 CAAAGATACTACCTGAGACTGGG + Intergenic
982299253 4:153862113-153862135 CAAACCTCCTAGATTAAACCAGG - Intergenic
982417621 4:155155711-155155733 GAAAGCTAGTACATTAAGCAGGG - Intergenic
982817610 4:159906101-159906123 CAGAGATGCTACATAAAACTGGG - Intergenic
986966878 5:13284315-13284337 GAAAGCTACTCCATAAAACTGGG - Intergenic
988423738 5:31038342-31038364 CAACCCTCCTACATTAAACCAGG + Intergenic
989283682 5:39674095-39674117 CACATCAACTTCATTAAACTGGG - Intergenic
990131280 5:52588648-52588670 CAAAGACACTTCATTAACCTTGG - Intergenic
991323422 5:65402425-65402447 CAATGCTACTACATTTCACTAGG + Intronic
992267298 5:75031998-75032020 GAAATCTACAAAATTAAACTGGG - Intergenic
992591682 5:78301967-78301989 CAAAGATACTACCTGAGACTGGG - Intergenic
993341885 5:86734799-86734821 CAAAGCTATTACATTTAATGAGG - Intergenic
993816963 5:92560461-92560483 CCAAGCTATTACATACAACTGGG + Intergenic
994630538 5:102280593-102280615 TAAAGATACTACCTGAAACTGGG + Intronic
994972498 5:106759325-106759347 CAAAGCTAGAACTTCAAACTAGG - Intergenic
995271877 5:110228910-110228932 GAAAGCTTCAACATTAGACTAGG + Intergenic
995607618 5:113874302-113874324 CAAAGCTAATACCTTAAAACTGG + Intergenic
995952312 5:117730775-117730797 CAAAGATACTACCTGAGACTGGG - Intergenic
996495045 5:124145623-124145645 CAACTCTCCTACATTAAACCAGG - Intergenic
996616139 5:125443352-125443374 CAACACTCCTATATTAAACTGGG + Intergenic
996882357 5:128313976-128313998 GAAAACTATTACATTAGACTAGG - Intronic
997230909 5:132242401-132242423 CAACCCTCCTAGATTAAACTAGG + Intronic
1000403772 5:160863874-160863896 CAACCCTCCTAGATTAAACTAGG + Intergenic
1001733492 5:173978531-173978553 CAACCCTACTAGATTAAACCAGG - Intronic
1003295462 6:4822396-4822418 CAAAGCTACAAATTTAATCTGGG + Intronic
1004085215 6:12441068-12441090 GAAAGCCTCTACACTAAACTAGG - Intergenic
1005226018 6:23642793-23642815 AAAAGCTACTCCTTTAAACCGGG - Intergenic
1006668789 6:35716839-35716861 CAAAGCTGCCACATCAACCTTGG + Intronic
1007330694 6:41105309-41105331 CAAAGCTTTTCCATTAGACTGGG - Intergenic
1008153383 6:47984215-47984237 TAAAGATACTACCTGAAACTGGG + Intronic
1010046301 6:71447934-71447956 CAAAACTACTACATAAAACAGGG - Intergenic
1010211459 6:73365633-73365655 TAAAGCTACTTAATTAAAATGGG - Intergenic
1010858136 6:80869226-80869248 CAACCCTCCTACATTAAACCAGG - Intergenic
1010862799 6:80934486-80934508 CAACCCTCCTACATTAAACCAGG - Intergenic
1012468513 6:99542714-99542736 CCAAGACACAACATTAAACTAGG + Exonic
1014396750 6:120932848-120932870 TAAAGCTACAACATGAACCTAGG + Intergenic
1015196695 6:130531259-130531281 CAAGCCTCCTAGATTAAACTAGG + Intergenic
1016728506 6:147402233-147402255 CAAAGATACTACCTGAAATTGGG - Intergenic
1016745308 6:147573223-147573245 TAAAGCTACTACCTGAGACTGGG + Intronic
1017326684 6:153149132-153149154 CAACCCTCCTAAATTAAACTAGG - Intergenic
1017857938 6:158367640-158367662 TACAGCTAGTACATTAAATTTGG + Intronic
1019122829 6:169817613-169817635 CAACTCTCCTAGATTAAACTGGG - Intergenic
1020332103 7:7029415-7029437 CAACCCTCCTAGATTAAACTAGG - Intergenic
1020573990 7:9902398-9902420 CACAGCTACAACATTAAATAGGG - Intergenic
1021547316 7:21829129-21829151 AAAAGCTTCTAGATTAGACTTGG - Intronic
1021664694 7:22964826-22964848 TAAACCTACTACATGAAACTTGG + Intronic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1023097641 7:36678382-36678404 CAAAGCTCCTTCATTTAATTTGG - Intronic
1026616518 7:71909875-71909897 CAAAGATACTACCTAAGACTGGG + Intronic
1028861235 7:95653157-95653179 CTATGCTACTACATTAAGCCTGG - Intergenic
1029099476 7:98116670-98116692 CAAATGTACTACATTAATATAGG - Intronic
1029925405 7:104311023-104311045 CCAAGTTACTAGAGTAAACTAGG + Intergenic
1030509160 7:110462234-110462256 TAAAGCTACTATAATAAAATTGG - Intergenic
1030754786 7:113274036-113274058 CAAAGATACTACCTGAGACTTGG + Intergenic
1030807474 7:113935657-113935679 TAAAGATACTACATGAGACTAGG + Intronic
1031800826 7:126242652-126242674 TAAAGATACTACATGAGACTGGG - Intergenic
1035178474 7:157071871-157071893 AAAAGCTACTCCATTAAAGTTGG - Intergenic
1038714545 8:29980175-29980197 TAAAGTTACTACATTTATCTGGG + Intergenic
1039206774 8:35164288-35164310 TAAAGATACTACTTGAAACTGGG - Intergenic
1039353148 8:36784421-36784443 CTAAGCTACGAAATGAAACTTGG + Exonic
1040597229 8:48850646-48850668 CAAAGCAAATAAATTAAAATAGG + Intergenic
1040820409 8:51550110-51550132 CAAACCTCCTAGATTAAACCTGG + Intronic
1041902327 8:62996129-62996151 AAAAGATACTACCTGAAACTGGG + Intronic
1042098881 8:65251081-65251103 CAAAAATACTACAATAAACATGG - Intergenic
1042902586 8:73744178-73744200 CAAAGCTCCTATATAGAACTTGG + Intronic
1043107365 8:76131536-76131558 CAAAACAACTCCATTAAAATGGG - Intergenic
1043545372 8:81309557-81309579 CAACCCTCCTAGATTAAACTAGG + Intergenic
1043876107 8:85488257-85488279 CAACGCTCCTAGATTAAACCAGG - Intergenic
1045825829 8:106396764-106396786 CAAAACTAAGACATTAACCTTGG - Intronic
1047095557 8:121621211-121621233 AAAATCTACTAAATTAAAATTGG - Intronic
1048041380 8:130732184-130732206 CAATGCTATTAAATTAAAATTGG + Intergenic
1048436593 8:134424186-134424208 AAAAGCTGCTACATTTATCTGGG + Intergenic
1048865656 8:138759698-138759720 CAAATTTACTTCATTAAACCTGG + Intronic
1050133358 9:2436389-2436411 CAAACCTCCTAGATTAAACCAGG - Intergenic
1050817169 9:9829647-9829669 CAAAACCACTACATTAAATGAGG + Intronic
1051042945 9:12836422-12836444 TAAAGCTACTAAATAAAATTGGG + Intergenic
1051113507 9:13667465-13667487 CAAAGCTACTAAAAGAAAATGGG - Intergenic
1052053075 9:23871183-23871205 CAAACCTCCTAGATTAAACCAGG + Intergenic
1052129149 9:24819930-24819952 TAAAGATACTACATGAGACTGGG - Intergenic
1055704777 9:78985933-78985955 TAAAACTACTACTTTAAGCTTGG + Intergenic
1055946245 9:81693753-81693775 GAAACCAACTAAATTAAACTGGG + Intergenic
1056396983 9:86190805-86190827 CAACCCTCCTACATTAAACCAGG + Intergenic
1056444617 9:86653781-86653803 TAAAGATACTACCTGAAACTGGG + Intergenic
1057369018 9:94452992-94453014 CAAAACTACTACATTTGACAAGG + Intronic
1060708107 9:125825874-125825896 CAAAGCTACTACATTAAACTTGG - Intronic
1186022297 X:5269820-5269842 CATTTCTACTACATTAAAATGGG + Intergenic
1187083896 X:16021756-16021778 CAAATCTATTACATTAATCGAGG + Intergenic
1191909145 X:66128735-66128757 CAACCCTCCTACATTAAACCAGG - Intergenic
1192377376 X:70577237-70577259 CAAAGATACTACATGAAAATGGG + Intronic
1192609977 X:72558011-72558033 CAACCCTCCTACATTAAACCAGG + Intronic
1193764330 X:85507854-85507876 TTAAGCTACTAAAATAAACTAGG + Intergenic
1194169630 X:90565281-90565303 TAAAGCTACTACCTGAGACTGGG - Intergenic
1194343826 X:92737576-92737598 CAAAGTTATTACATTACATTTGG - Intergenic
1196502802 X:116405121-116405143 CAAAGCTGCTTCATTAGAATGGG - Intergenic
1197134953 X:123050242-123050264 TAAAGATACTACATGAGACTGGG + Intergenic
1200515868 Y:4143055-4143077 TAAAGCTACTACCTGAGACTGGG - Intergenic