ID: 1060709939

View in Genome Browser
Species Human (GRCh38)
Location 9:125851199-125851221
Sequence GCAAATTTATTAGCTGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060709939_1060709940 -7 Left 1060709939 9:125851199-125851221 CCTCTATCAGCTAATAAATTTGC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 1060709940 9:125851215-125851237 AATTTGCCTTAAGTAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060709939 Original CRISPR GCAAATTTATTAGCTGATAG AGG (reversed) Intronic
902902674 1:19530420-19530442 GCAAATTCAGTATCTGATAAGGG - Intergenic
903202011 1:21749053-21749075 TCAAACATTTTAGCTGATAGTGG + Intronic
904127259 1:28249895-28249917 GCAAATTTATCATCTGAAGGTGG - Intergenic
905509684 1:38509180-38509202 GCAAATCTATTACCTAAAAGGGG + Intergenic
908217523 1:61969621-61969643 GCAAATTATTTATCTGATAAGGG - Intronic
908350182 1:63279048-63279070 CCACATTTATTAACTGAAAGTGG + Intergenic
908537769 1:65093948-65093970 GCAAATTATTCATCTGATAGGGG - Intergenic
908652766 1:66353956-66353978 GCATATTAATGAGCTGATGGAGG + Intronic
910159501 1:84258317-84258339 GCAAATATATTATCTGAGAAAGG + Intergenic
910271916 1:85405211-85405233 GTCTATTTATTAGCTGATATTGG + Intronic
911317506 1:96372731-96372753 GCAAATTACTTATCTGATAAAGG + Intergenic
911990562 1:104692073-104692095 GCAAAATTATTGGCTGGGAGCGG + Intergenic
916376897 1:164165182-164165204 GCAAATTTAACAGCAAATAGTGG + Intergenic
916487846 1:165275247-165275269 GCAAATTGCTTGCCTGATAGAGG - Intronic
917603951 1:176606317-176606339 GCAAAATGTTTAGCTGATAGTGG + Intronic
917834007 1:178926223-178926245 GCAAATTATCTAGCTGATAAGGG + Intergenic
918969264 1:191393403-191393425 GCAAATTGTTTATCTGATAAGGG + Intergenic
919250562 1:195051202-195051224 TCAATTTTATTATCTGATAATGG - Intergenic
921658644 1:217771873-217771895 GTAAAGTTAATAGCTGGTAGCGG + Intronic
923926408 1:238632311-238632333 GCAAATTAATTAGTTTAGAGGGG + Intergenic
1064068607 10:12205599-12205621 GCAAAGTTCTTGGCTGACAGTGG + Intronic
1064684417 10:17845008-17845030 GTAGCTTTATTAGCTGATAATGG + Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1068857633 10:61813594-61813616 GCAAAATCATTAGCTGAGAGTGG + Intergenic
1069220946 10:65882567-65882589 GCAAATTATCTATCTGATAGAGG - Intergenic
1071619016 10:87101756-87101778 ACAAATTAATTAGCTGGTTGTGG + Intronic
1071833841 10:89399274-89399296 GCAAATCTTGTACCTGATAGGGG - Intronic
1073173537 10:101534429-101534451 GCCAAATTATTAGGTGACAGTGG + Intronic
1074624704 10:115168710-115168732 GCAAATTATTTACCTGATAATGG - Intronic
1078644217 11:13124344-13124366 GCAAATTATATAGCTGATAAAGG + Intergenic
1079905800 11:26245699-26245721 GCAAATTTATTAGCATTTATGGG + Intergenic
1080561535 11:33467715-33467737 GAAAATCTGTGAGCTGATAGAGG + Intergenic
1081764513 11:45600294-45600316 GCAGATTAAATAGCTGATACGGG + Intergenic
1082153644 11:48774475-48774497 GAATATTTCTGAGCTGATAGAGG - Intergenic
1082307835 11:50604251-50604273 GCATATTTGATAGCTCATAGAGG + Intergenic
1083482152 11:62956261-62956283 AAAAATTAATTAGCTGAGAGTGG - Intronic
1092533152 12:9361813-9361835 GAAAATTCAGTAGTTGATAGGGG + Intergenic
1093824759 12:23670441-23670463 GCACATTTATTGGCTGAAAGGGG + Intronic
1095461381 12:42447831-42447853 GCAAATTTAAAAGCTAATTGAGG + Intronic
1096781025 12:53992168-53992190 GCAGAATTATTAGCAGAAAGAGG + Intronic
1096911666 12:54990326-54990348 TCAAAATTTTTAGATGATAGAGG + Intergenic
1097487194 12:60218864-60218886 GGAAATTATTTAGCTGATAAAGG - Intergenic
1097968614 12:65608532-65608554 GGACATTTATTAGCTGCTGGTGG - Intergenic
1098059282 12:66542798-66542820 GAAAATATATTTGCAGATAGGGG - Intronic
1098073090 12:66697119-66697141 GCAAATGTATTAATGGATAGAGG + Intronic
1099002258 12:77192643-77192665 AAAAATTAATTAGCTGAGAGTGG - Intergenic
1099665284 12:85620584-85620606 GGAAATTTAGTAGCTGCTATTGG - Intergenic
1099666445 12:85635890-85635912 GCAAATTATTTATCTGATAAGGG - Intergenic
1100183091 12:92106788-92106810 TCAAATGTATTAGCTGAGTGTGG + Intronic
1102754826 12:115329929-115329951 GCAAACTGTTTATCTGATAGGGG + Intergenic
1105080811 13:16114632-16114654 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105081037 13:16118061-16118083 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105081701 13:16128336-16128358 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105081921 13:16131765-16131787 GGAAATTTTTTAGCTGCTTGAGG + Intergenic
1105082153 13:16135191-16135213 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105082383 13:16138617-16138639 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105082608 13:16142040-16142062 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105082834 13:16145468-16145490 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105083062 13:16148895-16148917 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105083516 13:16155746-16155768 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105083743 13:16159171-16159193 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105083969 13:16162598-16162620 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105084213 13:16166812-16166834 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105084418 13:16170238-16170260 GGAAATTTCTTAGCTGCTCGAGG + Intergenic
1105084786 13:16177089-16177111 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105084979 13:16180512-16180534 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105085170 13:16183937-16183959 GGAAATTTCTTAGCTGATTCAGG + Intergenic
1105085361 13:16187362-16187384 GGAAATTTCTTAGCTGCTCGAGG + Intergenic
1105085555 13:16190787-16190809 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105085751 13:16194211-16194233 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105085945 13:16197638-16197660 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086134 13:16201063-16201085 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086339 13:16204488-16204510 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086539 13:16207914-16207936 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086730 13:16211339-16211361 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086925 13:16214764-16214786 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105087115 13:16218188-16218210 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105087313 13:16221612-16221634 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105087717 13:16228462-16228484 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1106041339 13:26096708-26096730 GCAAATGTGTTACCTGAAAGGGG - Intergenic
1107247451 13:38313551-38313573 GCAAATATAATAACTGAAAGAGG - Intergenic
1107376062 13:39805903-39805925 GCAAATTTTGTATCTGATAAGGG + Intergenic
1109006153 13:56880663-56880685 GCAAATTCATTATCTGATGAAGG - Intergenic
1109007097 13:56892171-56892193 GCAAATTTCTAAGCTGGTGGAGG + Intergenic
1109147052 13:58791808-58791830 GCACATGTATTGTCTGATAGAGG + Intergenic
1110361214 13:74627604-74627626 GCAAATTTATTAGTAGAAACAGG + Intergenic
1111462532 13:88565251-88565273 GAAAATTTAGTAGCTGATTTTGG - Intergenic
1111954251 13:94739835-94739857 GCAAATTTAGTATCTGGTAAGGG + Intergenic
1112866251 13:103903588-103903610 GCAAATCTTTTATCTGATAAGGG - Intergenic
1116114592 14:40630391-40630413 ACAAATTAATTACCTGATAAAGG - Intergenic
1116938215 14:50764107-50764129 GCAAATTAAGTATCTGATAAGGG + Intronic
1117098076 14:52317213-52317235 GCTATTTAAGTAGCTGATAGTGG - Intronic
1117947564 14:61045146-61045168 GCAAATATTTTATTTGATAGTGG - Intronic
1119047450 14:71331935-71331957 GCAAATTTAGTGGCTGCTATAGG + Intronic
1120304740 14:82754766-82754788 GCAAACTACTTAGCTGATGGGGG + Intergenic
1121066809 14:90974918-90974940 GAAAATTTATTAGCTGGGAAAGG + Intronic
1121416820 14:93785142-93785164 GCAAATTTATTAGGTGTGACAGG - Intronic
1123821962 15:24039587-24039609 GCAAATTTTATAGTTGATAATGG + Intergenic
1123829663 15:24121535-24121557 GCAAATTTTATAGGTGATAATGG - Intergenic
1123835244 15:24183414-24183436 GCAAATTTTATAGGTGATAATGG - Intergenic
1123844562 15:24284926-24284948 GCAAATTTTATAGGTGATAATGG - Intergenic
1123854941 15:24399313-24399335 GCAAATTTTATAGGTGATAATGG - Intergenic
1123859663 15:24451193-24451215 GCAAATTTTATAGGTGATAATGG - Intergenic
1123870970 15:24572308-24572330 GCAAATTTTATAGGTGATAATGG - Intergenic
1124213355 15:27782858-27782880 GCAAATTTATGAGCTAATGAAGG - Intronic
1131104184 15:89719483-89719505 TCAAATTTATTGGCTTAAAGTGG + Intronic
1133655647 16:7861113-7861135 ACAAAAATATTAGCTGAGAGTGG + Intergenic
1137466517 16:48714816-48714838 GCAATCTAATTAGCTGAAAGAGG + Intergenic
1137530676 16:49277009-49277031 GCAAATTTAGGACCTGATAGCGG + Intergenic
1140751245 16:78026035-78026057 GCAAATTCATCAGCTGGTGGGGG - Intronic
1203012632 16_KI270728v1_random:312691-312713 GCATATTTGTTAGCTCATTGAGG + Intergenic
1203030967 16_KI270728v1_random:585850-585872 GCATATTTGTTAGCTCATTGAGG + Intergenic
1203040754 16_KI270728v1_random:748581-748603 GCATATTTGTTAGCTCATTGAGG - Intergenic
1154404985 18:14082797-14082819 GCTACTTGAGTAGCTGATAGAGG - Intronic
1156111627 18:33734017-33734039 GCAAATGTATTACCTGCTAGGGG - Intronic
1156250939 18:35352215-35352237 GCAAATAAATTAGCTGAAAGTGG + Intergenic
1157316587 18:46595014-46595036 CAAAATTTCTTTGCTGATAGAGG - Intronic
1157873294 18:51249570-51249592 GCAAATTTATTGTCTGGTAAGGG + Intergenic
1159393406 18:67825589-67825611 GCAAATTATATATCTGATAGTGG + Intergenic
1163566222 19:18052832-18052854 GCAAATTTTGTATCTGATAAGGG + Intergenic
925038125 2:707648-707670 AGAAATTTATAAACTGATAGTGG + Intergenic
925708443 2:6713605-6713627 GCAAAATTATTTGATGATAGTGG + Intergenic
927629707 2:24762253-24762275 TCAATTTTTTTAGCTGATTGAGG + Intronic
928630559 2:33187334-33187356 GCACATTTATTAGCTCTTGGTGG - Intronic
928718622 2:34093287-34093309 GCAAATGTATTAACTGAAAAAGG + Intergenic
929716232 2:44313382-44313404 ACAAATGTAGGAGCTGATAGAGG - Intronic
929735882 2:44548726-44548748 GGAATTTTTTTAGCTGAGAGTGG + Intronic
930403043 2:50915387-50915409 GCAAATTTATTGGTTGAAGGAGG - Intronic
930644093 2:53885535-53885557 GGAAAATCATTAGGTGATAGTGG - Intronic
932186764 2:69703715-69703737 GAGAATTTAGTAGATGATAGTGG - Intronic
932445210 2:71776570-71776592 GCAAATTTATTGACTGCTTGGGG + Intergenic
934850265 2:97695057-97695079 GCAAATTGTTTATCTGATAAGGG - Intergenic
937275402 2:120680889-120680911 GCAAATATATTAGCTGGCTGTGG + Intergenic
941774254 2:169374702-169374724 GCAAATTCTTGAGCTGATGGTGG + Intergenic
942682847 2:178496288-178496310 GCAAATTTATTAGCTCAGAAAGG - Intronic
944440771 2:199741060-199741082 GCAAATTTTTTAACATATAGAGG - Intergenic
944991370 2:205240284-205240306 ACAAATTTATTAACTGTTAAGGG + Intronic
945325886 2:208481864-208481886 GCAAATATATTGACTGAGAGAGG + Intronic
947798597 2:232910897-232910919 GCAAATTACTTAACTGATAAAGG - Intronic
1171733904 20:28746027-28746049 GGAAATTTCTTAGCTGTTTGAGG + Intergenic
1171864303 20:30469680-30469702 GGAAATTTCTTAGCTGATTCAGG - Intergenic
1171895948 20:30761179-30761201 ACAAAAATATTAGCTGAGAGTGG + Intergenic
1173719610 20:45243564-45243586 GCAAATTTTATATCTGATAAGGG - Intergenic
1180355975 22:11840190-11840212 ACAAAAATATTAGCTGAGAGTGG - Intergenic
1180382281 22:12152136-12152158 ACAAAAATATTAGCTGAGAGTGG + Intergenic
1180919272 22:19511659-19511681 GCAAATTACTTATCTGATAAGGG - Intronic
1181117725 22:20643725-20643747 GCAACTTTTTTGGCTGAAAGAGG + Intergenic
953393417 3:42547524-42547546 GGAATTTTATTAGCTGCTATAGG + Intergenic
954866252 3:53732385-53732407 GCACATTTATTGGCTGATGTGGG + Intronic
956830708 3:73044852-73044874 GCAAATCTTTTATCTGATAAGGG - Intronic
958428254 3:94005538-94005560 GGAAATTCACTAGCTGAGAGAGG - Intronic
959411327 3:106026714-106026736 GCAAGTTCATTTGCTGAAAGTGG + Intergenic
960288541 3:115856726-115856748 GCAAATTTACTGTCTGATAAGGG - Intronic
961412756 3:126734695-126734717 GCAAATGTATAAGCTGCTGGTGG + Intronic
961541364 3:127602044-127602066 GCAAATTACATATCTGATAGAGG - Intronic
962797766 3:138863737-138863759 GTAACTTTATTAGTTCATAGTGG + Intergenic
962999375 3:140663922-140663944 GCAAATTATTTATCTGATAAGGG + Intergenic
964499195 3:157329954-157329976 GCAAATTTCTGAGCTTCTAGAGG - Intronic
964777375 3:160293009-160293031 GCAGCTTTATTGGCTGGTAGCGG + Intronic
966841749 3:184095138-184095160 GCAAATTATATAGCTGATAAGGG + Intergenic
970457455 4:16239154-16239176 GGAAATTTAGTAGCTGATCTTGG - Intergenic
970707546 4:18822956-18822978 GCAAACTTACTACCTCATAGAGG - Intergenic
973372200 4:49260494-49260516 ACAAAAATATTAGCTGAGAGTGG + Intergenic
973388795 4:49534641-49534663 ACAAAAATATTAGCTGAGAGTGG - Intergenic
979367834 4:119846831-119846853 GAAAATTTATGGACTGATAGAGG - Intergenic
983117720 4:163840071-163840093 TCAAATTTATTAGCATAAAGTGG - Intronic
984750964 4:183273659-183273681 GCAAATTATTTATCTGATAAGGG - Intronic
985361426 4:189179600-189179622 GCAAATTTATTTGATCTTAGTGG + Intergenic
988092784 5:26564253-26564275 ACAAATATAATAGCTAATAGAGG + Intergenic
988795278 5:34647766-34647788 TTAAATTTACTACCTGATAGAGG + Intergenic
989425763 5:41293697-41293719 GCAAATTTATCAGCTGAGAGAGG - Intergenic
990962526 5:61409726-61409748 GCAAATTTATTAGCTTTTTGTGG + Intronic
992738307 5:79745935-79745957 ACATATTTATTACCTGAGAGGGG - Intronic
993354293 5:86886886-86886908 GTGAATTTATTAGATGATTGTGG - Intergenic
993766848 5:91870250-91870272 GCCCATTTATAAGCTGATATTGG - Intergenic
994082094 5:95718432-95718454 GCAAATTTGTTAGCTAATTGTGG + Intronic
994355503 5:98789819-98789841 GCATATATATTAGTTCATAGAGG + Intronic
996664001 5:126036510-126036532 GCAAGTTCATCAGCTGAAAGAGG - Intergenic
996705995 5:126499330-126499352 GCAAATTGAATATCTGATAAAGG - Intergenic
997959838 5:138311792-138311814 GCAAATTATTTATCTGATAAGGG + Intronic
999605600 5:153311141-153311163 GTAAATGTATTAACTGATAAAGG - Intergenic
1001421215 5:171588812-171588834 GCAAATATAATACCTGAGAGGGG - Intergenic
1002154668 5:177267027-177267049 GCTAATTTTTTAGTAGATAGGGG + Intronic
1002962954 6:1933772-1933794 GCAAATTATATAGCTGATAAGGG - Intronic
1004693729 6:18014728-18014750 GGAAATTTACTACCTGATAAAGG - Intergenic
1006901672 6:37506740-37506762 GCCAATTTAATAGCTTATAAAGG + Intergenic
1008253211 6:49265625-49265647 GCAAATTCCTAAGCAGATAGGGG - Intergenic
1008739146 6:54584039-54584061 GCAAATTAATTCACTGATAGTGG - Intergenic
1009615838 6:66005509-66005531 GCAAATTGCTTATCTGACAGAGG - Intergenic
1009691824 6:67044478-67044500 CCAAATTTTTTAGCAGCTAGTGG + Intergenic
1010473532 6:76259610-76259632 GCAAATTATGTAGCTGATGGAGG + Intergenic
1012768624 6:103400496-103400518 GCAGATTAATTATCTGATAAGGG + Intergenic
1014678905 6:124403608-124403630 GCAAAATTCTTAGCACATAGTGG - Intronic
1016103573 6:140133584-140133606 GCAAATTACTCATCTGATAGGGG + Intergenic
1020425196 7:8057552-8057574 GGAAATTTTTTGGATGATAGAGG + Intronic
1020544670 7:9511510-9511532 GCAAATTAAATATCTGATAAAGG + Intergenic
1021382185 7:19981459-19981481 TCAAATTTATTGGCAGATAGTGG + Intergenic
1022145737 7:27538619-27538641 GCAAATTTATTACCTAGTGGAGG - Intronic
1022849438 7:34245158-34245180 ACACATTTTTTGGCTGATAGTGG + Intergenic
1024439069 7:49394556-49394578 ACAAATTTATAAGCTCTTAGTGG - Intergenic
1024803503 7:53108553-53108575 GCAAATTTAGCATCTGAGAGGGG + Intergenic
1026737926 7:72960667-72960689 GCACATTTAATAGCTGAAATAGG - Intronic
1026788960 7:73319462-73319484 GCACATTTAATAGCTGAAATAGG - Intronic
1027105808 7:75404401-75404423 GCACATTTAATAGCTGAAATAGG + Intronic
1028251464 7:88543741-88543763 TTTAATTTATTAGCTGACAGAGG - Intergenic
1035246322 7:157564521-157564543 GCAAATTACATAGCTGATAAGGG + Intronic
1037503788 8:19510558-19510580 ACAAATTTACTAGCTTGTAGAGG + Intronic
1040013127 8:42678804-42678826 CCAAGTTTATGGGCTGATAGAGG - Intergenic
1041726531 8:61023243-61023265 GGTAGTTTATTAGCTGAAAGAGG + Intergenic
1042582737 8:70299376-70299398 GCAAAATAATTATCTGATAAAGG + Intronic
1043466583 8:80513960-80513982 GCAAATTTATTGGCTGAAGCTGG + Exonic
1044816953 8:96123398-96123420 GCAAATTGTATATCTGATAGGGG - Intergenic
1045458396 8:102405198-102405220 GCAATTAAATTACCTGATAGAGG + Intronic
1046222805 8:111237551-111237573 AGAAATTTATTATCTTATAGTGG + Intergenic
1048248418 8:132834984-132835006 GCAAGATTAGAAGCTGATAGAGG + Intronic
1050918806 9:11172548-11172570 GGAAATATATTTGCTGATTGTGG + Intergenic
1054352697 9:64031597-64031619 ACAAAAATATTAGCTGACAGTGG - Intergenic
1055031668 9:71776269-71776291 GCAAATTTATAAGATATTAGTGG - Intronic
1057364129 9:94402813-94402835 GCAAAACTATTAGCTTCTAGAGG - Intronic
1057659209 9:96985250-96985272 GCAAAACTATTAGCTTCTAGAGG + Intronic
1060709939 9:125851199-125851221 GCAAATTTATTAGCTGATAGAGG - Intronic
1203696423 Un_GL000214v1:102771-102793 ACAAAAATATTAGCTGAGAGTGG + Intergenic
1203741038 Un_GL000218v1:696-718 ACAAAAATATTAGCTGAGAGTGG - Intergenic
1203553301 Un_KI270743v1:182506-182528 ACAAAAATATTAGCTGAGAGTGG - Intergenic
1203639850 Un_KI270751v1:1292-1314 ACAAAAATATTAGCTGAGAGTGG - Intergenic
1187209386 X:17214167-17214189 ACAAATTTTTTATCTTATAGAGG + Intergenic
1187351184 X:18518936-18518958 GTAACATTATTAGCTGATAATGG + Intronic
1187576390 X:20560914-20560936 GCAAATGTAGTGACTGATAGAGG - Intergenic
1187909123 X:24094086-24094108 GCAAATTTTTTCACAGATAGGGG - Intergenic
1187946866 X:24434433-24434455 GCAAATTATTTATCTGATAAGGG + Intergenic
1188448675 X:30285652-30285674 GCAAATTCATGAGCTGATCCTGG - Intergenic
1188620098 X:32210127-32210149 TCAAAGTTATTAGCTGGTAGTGG - Intronic
1190187486 X:48248456-48248478 GCTAATTTTTTAGTAGATAGGGG + Intronic
1190915187 X:54806671-54806693 GTGAATTTATTATGTGATAGAGG + Intergenic
1191036985 X:56035874-56035896 GCAAATTATTTATCTGACAGGGG - Intergenic
1191228867 X:58078354-58078376 GAACATTTCTTAGCTCATAGAGG - Intergenic
1193541546 X:82778908-82778930 GCAAATTTATTAGATATTACTGG - Intergenic
1193693146 X:84672487-84672509 TCAAATTTATTAGCATATAGTGG - Intergenic
1195257184 X:103102174-103102196 CCAAATGTATTAGGTGGTAGAGG + Intergenic
1196396194 X:115263852-115263874 GAAAATGTATTAACTGAGAGGGG + Intergenic
1198393021 X:136195555-136195577 GTAAATTTATTACATGTTAGAGG - Intronic
1199620433 X:149696213-149696235 GCAAATTTATTTCCTGGAAGAGG + Intronic