ID: 1060712640

View in Genome Browser
Species Human (GRCh38)
Location 9:125884456-125884478
Sequence CTGCTTCATAATTGCAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060712640 Original CRISPR CTGCTTCATAATTGCAAACC TGG (reversed) Intronic
909385652 1:75053323-75053345 CTGCTTCATTATTGCAGAGCAGG - Intergenic
910021476 1:82595051-82595073 CAGCTTTATAATTGTAAACCAGG + Intergenic
910470736 1:87549840-87549862 CTGTTTCAAAATAGAAAACCTGG + Intergenic
912060837 1:105667044-105667066 ATGCTTCAGAATTATAAACCTGG - Intergenic
912911875 1:113769356-113769378 CTGATTCAAGATTGCAAACCAGG + Intronic
915523932 1:156464784-156464806 CTGCCTCATAAAGGCAAACCTGG - Exonic
919507775 1:198421507-198421529 ATTATTCATAATTGCATACCTGG + Intergenic
921117319 1:212105664-212105686 CTGCTTCATAATTCCATAAAGGG + Intronic
921751910 1:218804478-218804500 CTGCCTCCTAAGTGCAAAGCTGG + Intergenic
924262234 1:242243836-242243858 CTGCTTTTTAATTGGAAACACGG + Intronic
1064106274 10:12503373-12503395 CTGCTTCTCAACTGTAAACCTGG - Intronic
1064389988 10:14933961-14933983 CTGCTAAATAACTGCAAACAGGG - Intronic
1064400423 10:15016489-15016511 CTGCTAAATAACTGCAAACAGGG - Intergenic
1068729016 10:60335542-60335564 CAGCTGCAGAATAGCAAACCAGG + Intronic
1068862657 10:61863488-61863510 ATGCTTCATAATTGAAGGCCTGG - Intergenic
1068916121 10:62433609-62433631 CTGCTTCTTAAATCCAAATCTGG - Intronic
1069544103 10:69316999-69317021 CTGGATCATAATTATAAACCAGG - Intronic
1072074210 10:91952528-91952550 GAGATTCATAATTGCAAAGCAGG - Intronic
1072782458 10:98259851-98259873 CTGCCTGGTAATTGCACACCTGG - Intronic
1078314508 11:10281892-10281914 CAACTTCAAAATTGCAGACCTGG - Intronic
1083108821 11:60385253-60385275 ATGCTTTATAAATGCTAACCAGG + Intronic
1086592236 11:88529042-88529064 CTGCTACTTATTTGCAAAACGGG - Intronic
1087814813 11:102646962-102646984 TTGCTATATAATTTCAAACCAGG + Intergenic
1088540631 11:110910120-110910142 TTGCTTAATGATTGTAAACCTGG - Intergenic
1090995618 11:131863353-131863375 CTTTTTCTTTATTGCAAACCTGG + Intronic
1091453161 12:586321-586343 CTGCTTCATTATTTCCATCCCGG + Intronic
1095358365 12:41305259-41305281 CTACTGCATCATTGGAAACCTGG + Intronic
1106483418 13:30153862-30153884 CTGTTTCATAAATGAAAAGCTGG + Intergenic
1106989002 13:35393679-35393701 CTACTTCATAGTTGCAAATTTGG - Intronic
1108716933 13:53090181-53090203 CTGCTTCCTACTTGCAAGCAGGG + Intergenic
1108934663 13:55869705-55869727 AGTCTTCAGAATTGCAAACCTGG + Intergenic
1109494725 13:63153950-63153972 CTACTCAATAAATGCAAACCTGG - Intergenic
1110113111 13:71776091-71776113 CTGCTTAATTATTCCAAAGCTGG - Intronic
1115772505 14:36680555-36680577 CTCCTTCATAATTATACACCTGG + Exonic
1118999919 14:70872548-70872570 CTCCCTCACAATTGAAAACCAGG + Intergenic
1119114858 14:72009930-72009952 CTGCTTCATAATACCAAGCCAGG - Intronic
1121585040 14:95057502-95057524 CTGTTTAATAATTGTAAACCAGG + Intergenic
1121645276 14:95514231-95514253 CTGCTTCAAAACTGGAAGCCAGG - Intergenic
1121645618 14:95515835-95515857 CTGCTTCAAAACTGGAAGCCAGG - Intergenic
1122887988 14:104719040-104719062 CTGCTTCCTAAAGGCAACCCTGG + Exonic
1124381283 15:29168876-29168898 CTATTTGATAATTGAAAACCTGG + Intronic
1124630610 15:31334808-31334830 CTGCTTCTGAATTGCCAAGCTGG - Intronic
1127628118 15:60800361-60800383 CTGCTTCATAACTGAATCCCAGG - Intronic
1131328532 15:91472593-91472615 CCTATTCATAATTGCAAACTTGG - Intergenic
1137527757 16:49250997-49251019 CTGCTGGATAAATGCATACCAGG - Intergenic
1143382443 17:6504713-6504735 CTGCATTATAATTGGATACCTGG + Intronic
1149946396 17:60932333-60932355 TTGCTTCATAATTGTAATCATGG + Intronic
1150593716 17:66585239-66585261 CTGCTTCTTTATTGCACACCTGG + Intronic
1154020271 18:10658494-10658516 CTGCTTCTTTATTGCACACGTGG + Intergenic
1157971526 18:52275086-52275108 ATTCTTCATTATTGAAAACCCGG - Intergenic
1158867907 18:61655715-61655737 CTGCTTCAGAATTGGAAAACTGG + Intergenic
1158867998 18:61656796-61656818 CTGCTTCAGAATTGGAAAACTGG + Intergenic
1159414270 18:68124059-68124081 CTGCATAATAATTCCAAACATGG + Intergenic
1168112828 19:54203903-54203925 ATGCTTTAAAAATGCAAACCAGG - Intronic
925313043 2:2901224-2901246 CTTCTTCATAATTACAAAGTAGG + Intergenic
925464672 2:4096245-4096267 ATGCTTCGAGATTGCAAACCAGG - Intergenic
926047614 2:9721304-9721326 CTGCTTCATCATTGAATCCCTGG - Intergenic
927725754 2:25421463-25421485 TTGCTTCCTAACTGCAAAGCAGG - Intronic
928389340 2:30897315-30897337 CTGCTTCATCTTGCCAAACCGGG - Intergenic
931642476 2:64393979-64394001 CTGCTTCATCATTGCTAAGTTGG - Intergenic
932818106 2:74877716-74877738 CTGCTTCATAATAGAAAGCTAGG + Intronic
933235875 2:79863909-79863931 CTGCTACAGAATTGCACAGCGGG + Intronic
934900401 2:98155250-98155272 CTGCATCAGAATTACAAACTGGG + Intronic
936148469 2:109997292-109997314 CTGCTTCATCGTCCCAAACCAGG - Intergenic
936196208 2:110374076-110374098 CTGCTTCATCGTCCCAAACCAGG + Intergenic
936248111 2:110846148-110846170 CTGCTTCCAAATTCCAAATCTGG - Intronic
940674146 2:156708332-156708354 CTGATTCTTATTTGCAGACCAGG - Intergenic
943128665 2:183828573-183828595 CAGCTATATAACTGCAAACCTGG + Intergenic
946749956 2:222884207-222884229 CTGTTTCATAATATTAAACCTGG - Intronic
1170314322 20:15027027-15027049 CTGGTTCAAAATTGAACACCTGG + Intronic
1170445475 20:16423003-16423025 CTGCTTCAAAAGTGAAAACATGG + Intronic
1174180989 20:48674595-48674617 CAGCTTCATAGTAGCAAAGCTGG - Intronic
1177971820 21:27799282-27799304 CGGCTTAATTATTTCAAACCTGG + Intergenic
1181500198 22:23311611-23311633 CTGCTCCATATCTGCACACCCGG - Intronic
1182607816 22:31520644-31520666 CTGCATCATAATTAAAATCCAGG + Intronic
1184551630 22:45207622-45207644 CTGCTTCAAAATTGAAAGCCAGG - Intronic
956352744 3:68355620-68355642 CTGCGTCATAATTGTGAACATGG + Intronic
960407857 3:117284011-117284033 CTGCTTCATAATGACACAACTGG - Intergenic
960857353 3:122116625-122116647 TTGCTTCATAATACCAAACCTGG + Intronic
961397320 3:126604382-126604404 TTACTTCATAATTGCAAACAAGG - Intronic
961522152 3:127473103-127473125 CTGCTTCATAACTGCAGTGCTGG - Intergenic
962050728 3:131812139-131812161 CTGCATCCTAATTGCAATCCTGG - Intronic
962958380 3:140287173-140287195 CTGATTCATATTTTCATACCTGG - Intronic
964370671 3:155996969-155996991 TTGCTTAATAAATGCAAAACTGG + Intergenic
965620453 3:170637642-170637664 CTGCCCCATAATTGCAAACAGGG - Intronic
972118510 4:35669416-35669438 CTGCTTAAAAAAGGCAAACCTGG + Intergenic
973131915 4:46658415-46658437 ATGCTTCATCATTGCATACTGGG - Intergenic
974487308 4:62522586-62522608 CTGCTTGATTATGACAAACCTGG - Intergenic
977753813 4:100641435-100641457 CAGATTAATAATTGCATACCAGG + Intronic
983073918 4:163302119-163302141 CTGTTTCATAACTGCATACATGG - Intergenic
988144575 5:27289276-27289298 CTACTTCATTCTTGCAAAACAGG - Intergenic
990764669 5:59168891-59168913 CTGCTTCATAGATGCAAAACTGG - Intronic
991679376 5:69123854-69123876 CTACTTTATAATTGCAAAGTAGG - Intronic
993219624 5:85074947-85074969 CTGCTTATTATTTGCAACCCTGG - Intergenic
995269218 5:110202297-110202319 CTCCTTCATCCTTACAAACCTGG + Intergenic
997743476 5:136278333-136278355 CTGCTTTCAAATTGCAAATCTGG + Intronic
999500099 5:152138255-152138277 GAGCTTCATTTTTGCAAACCAGG - Intergenic
1000687808 5:164274120-164274142 TTGCTTCACAGTTGCAAACTCGG + Intergenic
1004282863 6:14295721-14295743 CTGCTTCATACAAGGAAACCAGG - Intergenic
1013976524 6:116085044-116085066 ATCCTTCATAATTTCAAAGCAGG - Intergenic
1017251874 6:152289246-152289268 CTGATTTGTAATTGCAAACTTGG + Intronic
1018648330 6:165968939-165968961 ATGATTCTTAAGTGCAAACCTGG - Intronic
1021518283 7:21510631-21510653 CTTCTTCAAAACTGCTAACCTGG - Intronic
1022041138 7:26582457-26582479 CTGCTGCTTAATTCCAAAGCTGG - Intergenic
1022987599 7:35673996-35674018 CTACTTCATAACTGCAAAACAGG + Intronic
1023593227 7:41800927-41800949 CTGCTTCAAAAATGCTACCCGGG + Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1033016487 7:137676644-137676666 CTTCCTCATAATTTCATACCAGG - Intronic
1039598298 8:38810814-38810836 CTGCTTCAAAATCCCAAAACAGG + Intronic
1040383046 8:46891688-46891710 CTGCTTCGGTATTGCTAACCTGG - Intergenic
1042986478 8:74589361-74589383 CTCCTTCAAAATTGTAGACCAGG - Intergenic
1043994568 8:86797027-86797049 CTTTTTAATAATTACAAACCTGG - Intergenic
1044639811 8:94367368-94367390 CTGCTTTATACGTGCAAACCAGG + Intergenic
1052402139 9:28013690-28013712 CTGCTTCTTATTAGCAAGCCAGG - Intronic
1054708815 9:68490177-68490199 CTGCTTCATATTTGCTGACCAGG - Intronic
1055294324 9:74818657-74818679 CTGCTTCATCATTTCCAAACTGG + Intronic
1055699395 9:78926368-78926390 CTGCTTAATAATTTTCAACCGGG + Intergenic
1056944491 9:90983035-90983057 GTGCTCCATGACTGCAAACCTGG - Intergenic
1058543633 9:106038099-106038121 CTGTTTCATAAATGCATGCCAGG - Intergenic
1059996396 9:119914345-119914367 TTGCTTCATGATTGAAACCCAGG + Intergenic
1060712640 9:125884456-125884478 CTGCTTCATAATTGCAAACCTGG - Intronic
1061515160 9:131085512-131085534 CAGCTTCATTCCTGCAAACCCGG - Exonic
1195135433 X:101902063-101902085 CTGCTTCAAAATTTTATACCTGG - Intronic
1199201688 X:145097481-145097503 CTGCCTCATCATTGTAAACTGGG - Intergenic
1200928895 Y:8679268-8679290 CTGCCTCATGAATGCACACCAGG - Intergenic