ID: 1060712941

View in Genome Browser
Species Human (GRCh38)
Location 9:125889181-125889203
Sequence TGGGTTCGCCCACATCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060712939_1060712941 -4 Left 1060712939 9:125889162-125889184 CCTTAATTTCAGTTAAGTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1060712941 9:125889181-125889203 TGGGTTCGCCCACATCCCCGTGG No data
1060712935_1060712941 11 Left 1060712935 9:125889147-125889169 CCCCAGGAACGTAGGCCTTAATT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1060712941 9:125889181-125889203 TGGGTTCGCCCACATCCCCGTGG No data
1060712937_1060712941 9 Left 1060712937 9:125889149-125889171 CCAGGAACGTAGGCCTTAATTTC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1060712941 9:125889181-125889203 TGGGTTCGCCCACATCCCCGTGG No data
1060712936_1060712941 10 Left 1060712936 9:125889148-125889170 CCCAGGAACGTAGGCCTTAATTT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1060712941 9:125889181-125889203 TGGGTTCGCCCACATCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060712941 Original CRISPR TGGGTTCGCCCACATCCCCG TGG Intronic
No off target data available for this crispr