ID: 1060713698

View in Genome Browser
Species Human (GRCh38)
Location 9:125898551-125898573
Sequence ACTAAATTCTGAACTGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060713695_1060713698 18 Left 1060713695 9:125898510-125898532 CCTCTTATTATAGTTTGTGGTTA 0: 1
1: 0
2: 2
3: 17
4: 233
Right 1060713698 9:125898551-125898573 ACTAAATTCTGAACTGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060713698 Original CRISPR ACTAAATTCTGAACTGGTTC AGG Intronic
No off target data available for this crispr