ID: 1060719792

View in Genome Browser
Species Human (GRCh38)
Location 9:125969281-125969303
Sequence CTTGATGCAGAAAAGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060719792_1060719796 -9 Left 1060719792 9:125969281-125969303 CCAGGTACCTTTTCTGCATCAAG No data
Right 1060719796 9:125969295-125969317 TGCATCAAGCAGTGGGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060719792 Original CRISPR CTTGATGCAGAAAAGGTACC TGG (reversed) Intergenic
No off target data available for this crispr