ID: 1060719945

View in Genome Browser
Species Human (GRCh38)
Location 9:125970058-125970080
Sequence CAGAGCCTGTCTGATACTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060719945_1060719950 10 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719950 9:125970091-125970113 GCCATCAGGCCTCCAGTATGAGG No data
1060719945_1060719953 21 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719953 9:125970102-125970124 TCCAGTATGAGGTCCCGTCTTGG No data
1060719945_1060719949 -4 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719949 9:125970077-125970099 TCTGGTGAACTTGGGCCATCAGG No data
1060719945_1060719958 25 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719958 9:125970106-125970128 GTATGAGGTCCCGTCTTGGGGGG No data
1060719945_1060719955 22 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719955 9:125970103-125970125 CCAGTATGAGGTCCCGTCTTGGG No data
1060719945_1060719959 28 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719959 9:125970109-125970131 TGAGGTCCCGTCTTGGGGGGAGG No data
1060719945_1060719956 23 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719956 9:125970104-125970126 CAGTATGAGGTCCCGTCTTGGGG No data
1060719945_1060719957 24 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719957 9:125970105-125970127 AGTATGAGGTCCCGTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060719945 Original CRISPR CAGAGCCTGTCTGATACTAG TGG (reversed) Intergenic
No off target data available for this crispr