ID: 1060719956

View in Genome Browser
Species Human (GRCh38)
Location 9:125970104-125970126
Sequence CAGTATGAGGTCCCGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060719945_1060719956 23 Left 1060719945 9:125970058-125970080 CCACTAGTATCAGACAGGCTCTG No data
Right 1060719956 9:125970104-125970126 CAGTATGAGGTCCCGTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060719956 Original CRISPR CAGTATGAGGTCCCGTCTTG GGG Intergenic
No off target data available for this crispr