ID: 1060720313

View in Genome Browser
Species Human (GRCh38)
Location 9:125972198-125972220
Sequence GGTGGCGCCCAGACGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060720313_1060720320 15 Left 1060720313 9:125972198-125972220 CCTGCTTCCGTCTGGGCGCCACC No data
Right 1060720320 9:125972236-125972258 AGCCACACCTCACGGCCAAGTGG No data
1060720313_1060720318 7 Left 1060720313 9:125972198-125972220 CCTGCTTCCGTCTGGGCGCCACC No data
Right 1060720318 9:125972228-125972250 CTGCCAGGAGCCACACCTCACGG No data
1060720313_1060720321 16 Left 1060720313 9:125972198-125972220 CCTGCTTCCGTCTGGGCGCCACC No data
Right 1060720321 9:125972237-125972259 GCCACACCTCACGGCCAAGTGGG No data
1060720313_1060720315 -8 Left 1060720313 9:125972198-125972220 CCTGCTTCCGTCTGGGCGCCACC No data
Right 1060720315 9:125972213-125972235 GCGCCACCAAATGTACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060720313 Original CRISPR GGTGGCGCCCAGACGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr