ID: 1060723451

View in Genome Browser
Species Human (GRCh38)
Location 9:125992930-125992952
Sequence CATTATCCACAGAGAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060723451_1060723459 25 Left 1060723451 9:125992930-125992952 CCTGGCTCTCTCTGTGGATAATG No data
Right 1060723459 9:125992978-125993000 GAGTCCTCCCTTGGTGCCTGGGG No data
1060723451_1060723453 -1 Left 1060723451 9:125992930-125992952 CCTGGCTCTCTCTGTGGATAATG No data
Right 1060723453 9:125992952-125992974 GGTTCTTACAGCCGTTTCCATGG No data
1060723451_1060723456 16 Left 1060723451 9:125992930-125992952 CCTGGCTCTCTCTGTGGATAATG No data
Right 1060723456 9:125992969-125992991 CCATGGACTGAGTCCTCCCTTGG No data
1060723451_1060723457 23 Left 1060723451 9:125992930-125992952 CCTGGCTCTCTCTGTGGATAATG No data
Right 1060723457 9:125992976-125992998 CTGAGTCCTCCCTTGGTGCCTGG No data
1060723451_1060723458 24 Left 1060723451 9:125992930-125992952 CCTGGCTCTCTCTGTGGATAATG No data
Right 1060723458 9:125992977-125992999 TGAGTCCTCCCTTGGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060723451 Original CRISPR CATTATCCACAGAGAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr