ID: 1060723685

View in Genome Browser
Species Human (GRCh38)
Location 9:125994203-125994225
Sequence CAGAGCTAAGAGCAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060723685_1060723698 13 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723698 9:125994239-125994261 CCAGGGGCAGAGGAGGGAACAGG No data
1060723685_1060723695 6 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723695 9:125994232-125994254 GGTGTTGCCAGGGGCAGAGGAGG No data
1060723685_1060723699 21 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723699 9:125994247-125994269 AGAGGAGGGAACAGGCCCAGAGG No data
1060723685_1060723694 3 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723694 9:125994229-125994251 GCTGGTGTTGCCAGGGGCAGAGG No data
1060723685_1060723691 -5 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723691 9:125994221-125994243 CTCTGGGAGCTGGTGTTGCCAGG No data
1060723685_1060723700 22 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723700 9:125994248-125994270 GAGGAGGGAACAGGCCCAGAGGG No data
1060723685_1060723692 -4 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723685_1060723693 -3 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723693 9:125994223-125994245 CTGGGAGCTGGTGTTGCCAGGGG No data
1060723685_1060723701 23 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723701 9:125994249-125994271 AGGAGGGAACAGGCCCAGAGGGG No data
1060723685_1060723696 7 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723696 9:125994233-125994255 GTGTTGCCAGGGGCAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060723685 Original CRISPR CAGAGCTAAGAGCAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr