ID: 1060723692

View in Genome Browser
Species Human (GRCh38)
Location 9:125994222-125994244
Sequence TCTGGGAGCTGGTGTTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060723688_1060723692 -7 Left 1060723688 9:125994206-125994228 CCATCCTGCTCTTAGCTCTGGGA No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723681_1060723692 17 Left 1060723681 9:125994182-125994204 CCACTCCAAGGCATGCCCTGGCC No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723676_1060723692 21 Left 1060723676 9:125994178-125994200 CCCCCCACTCCAAGGCATGCCCT No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723685_1060723692 -4 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723684_1060723692 1 Left 1060723684 9:125994198-125994220 CCTGGCCTCCATCCTGCTCTTAG No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723683_1060723692 2 Left 1060723683 9:125994197-125994219 CCCTGGCCTCCATCCTGCTCTTA No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723682_1060723692 12 Left 1060723682 9:125994187-125994209 CCAAGGCATGCCCTGGCCTCCAT No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723678_1060723692 19 Left 1060723678 9:125994180-125994202 CCCCACTCCAAGGCATGCCCTGG No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723680_1060723692 18 Left 1060723680 9:125994181-125994203 CCCACTCCAAGGCATGCCCTGGC No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data
1060723677_1060723692 20 Left 1060723677 9:125994179-125994201 CCCCCACTCCAAGGCATGCCCTG No data
Right 1060723692 9:125994222-125994244 TCTGGGAGCTGGTGTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060723692 Original CRISPR TCTGGGAGCTGGTGTTGCCA GGG Intergenic
No off target data available for this crispr