ID: 1060723698

View in Genome Browser
Species Human (GRCh38)
Location 9:125994239-125994261
Sequence CCAGGGGCAGAGGAGGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060723689_1060723698 6 Left 1060723689 9:125994210-125994232 CCTGCTCTTAGCTCTGGGAGCTG No data
Right 1060723698 9:125994239-125994261 CCAGGGGCAGAGGAGGGAACAGG No data
1060723688_1060723698 10 Left 1060723688 9:125994206-125994228 CCATCCTGCTCTTAGCTCTGGGA No data
Right 1060723698 9:125994239-125994261 CCAGGGGCAGAGGAGGGAACAGG No data
1060723684_1060723698 18 Left 1060723684 9:125994198-125994220 CCTGGCCTCCATCCTGCTCTTAG No data
Right 1060723698 9:125994239-125994261 CCAGGGGCAGAGGAGGGAACAGG No data
1060723682_1060723698 29 Left 1060723682 9:125994187-125994209 CCAAGGCATGCCCTGGCCTCCAT No data
Right 1060723698 9:125994239-125994261 CCAGGGGCAGAGGAGGGAACAGG No data
1060723683_1060723698 19 Left 1060723683 9:125994197-125994219 CCCTGGCCTCCATCCTGCTCTTA No data
Right 1060723698 9:125994239-125994261 CCAGGGGCAGAGGAGGGAACAGG No data
1060723685_1060723698 13 Left 1060723685 9:125994203-125994225 CCTCCATCCTGCTCTTAGCTCTG No data
Right 1060723698 9:125994239-125994261 CCAGGGGCAGAGGAGGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060723698 Original CRISPR CCAGGGGCAGAGGAGGGAAC AGG Intergenic
No off target data available for this crispr