ID: 1060723760

View in Genome Browser
Species Human (GRCh38)
Location 9:125994526-125994548
Sequence GTGGCCAAATGCAGGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060723760_1060723766 11 Left 1060723760 9:125994526-125994548 CCTGGATGCCTGCATTTGGCCAC No data
Right 1060723766 9:125994560-125994582 AGGGTCTCTGTTTGTGGCTGAGG No data
1060723760_1060723765 5 Left 1060723760 9:125994526-125994548 CCTGGATGCCTGCATTTGGCCAC No data
Right 1060723765 9:125994554-125994576 CAAGACAGGGTCTCTGTTTGTGG No data
1060723760_1060723768 23 Left 1060723760 9:125994526-125994548 CCTGGATGCCTGCATTTGGCCAC No data
Right 1060723768 9:125994572-125994594 TGTGGCTGAGGGTTTGTACCTGG No data
1060723760_1060723767 12 Left 1060723760 9:125994526-125994548 CCTGGATGCCTGCATTTGGCCAC No data
Right 1060723767 9:125994561-125994583 GGGTCTCTGTTTGTGGCTGAGGG No data
1060723760_1060723763 -8 Left 1060723760 9:125994526-125994548 CCTGGATGCCTGCATTTGGCCAC No data
Right 1060723763 9:125994541-125994563 TTGGCCACATGCGCAAGACAGGG No data
1060723760_1060723762 -9 Left 1060723760 9:125994526-125994548 CCTGGATGCCTGCATTTGGCCAC No data
Right 1060723762 9:125994540-125994562 TTTGGCCACATGCGCAAGACAGG No data
1060723760_1060723769 24 Left 1060723760 9:125994526-125994548 CCTGGATGCCTGCATTTGGCCAC No data
Right 1060723769 9:125994573-125994595 GTGGCTGAGGGTTTGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060723760 Original CRISPR GTGGCCAAATGCAGGCATCC AGG (reversed) Intergenic
No off target data available for this crispr