ID: 1060724683

View in Genome Browser
Species Human (GRCh38)
Location 9:125999152-125999174
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060724677_1060724683 22 Left 1060724677 9:125999107-125999129 CCACTGTGTCTCTTTGGGTGACA No data
Right 1060724683 9:125999152-125999174 CCGTGCCCCGCCTTTGCCTTCGG No data
1060724681_1060724683 -10 Left 1060724681 9:125999139-125999161 CCTGGAGAGGAGGCCGTGCCCCG No data
Right 1060724683 9:125999152-125999174 CCGTGCCCCGCCTTTGCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060724683 Original CRISPR CCGTGCCCCGCCTTTGCCTT CGG Intergenic
No off target data available for this crispr