ID: 1060731157

View in Genome Browser
Species Human (GRCh38)
Location 9:126037877-126037899
Sequence ATCATTTTACAGATGGAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060731157_1060731160 -3 Left 1060731157 9:126037877-126037899 CCGTACTCCATCTGTAAAATGAT No data
Right 1060731160 9:126037897-126037919 GATCACTCCATTTTCCAGATGGG No data
1060731157_1060731165 14 Left 1060731157 9:126037877-126037899 CCGTACTCCATCTGTAAAATGAT No data
Right 1060731165 9:126037914-126037936 GATGGGGAGAGAAGTGTGGCAGG No data
1060731157_1060731159 -4 Left 1060731157 9:126037877-126037899 CCGTACTCCATCTGTAAAATGAT No data
Right 1060731159 9:126037896-126037918 TGATCACTCCATTTTCCAGATGG No data
1060731157_1060731163 10 Left 1060731157 9:126037877-126037899 CCGTACTCCATCTGTAAAATGAT No data
Right 1060731163 9:126037910-126037932 TCCAGATGGGGAGAGAAGTGTGG No data
1060731157_1060731161 -2 Left 1060731157 9:126037877-126037899 CCGTACTCCATCTGTAAAATGAT No data
Right 1060731161 9:126037898-126037920 ATCACTCCATTTTCCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060731157 Original CRISPR ATCATTTTACAGATGGAGTA CGG (reversed) Intergenic
No off target data available for this crispr