ID: 1060731159

View in Genome Browser
Species Human (GRCh38)
Location 9:126037896-126037918
Sequence TGATCACTCCATTTTCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060731157_1060731159 -4 Left 1060731157 9:126037877-126037899 CCGTACTCCATCTGTAAAATGAT No data
Right 1060731159 9:126037896-126037918 TGATCACTCCATTTTCCAGATGG No data
1060731153_1060731159 29 Left 1060731153 9:126037844-126037866 CCGAGGTCAACAAATCCTTACAA No data
Right 1060731159 9:126037896-126037918 TGATCACTCCATTTTCCAGATGG No data
1060731155_1060731159 2 Left 1060731155 9:126037871-126037893 CCCATGCCGTACTCCATCTGTAA No data
Right 1060731159 9:126037896-126037918 TGATCACTCCATTTTCCAGATGG No data
1060731154_1060731159 14 Left 1060731154 9:126037859-126037881 CCTTACAATAAGCCCATGCCGTA No data
Right 1060731159 9:126037896-126037918 TGATCACTCCATTTTCCAGATGG No data
1060731156_1060731159 1 Left 1060731156 9:126037872-126037894 CCATGCCGTACTCCATCTGTAAA No data
Right 1060731159 9:126037896-126037918 TGATCACTCCATTTTCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060731159 Original CRISPR TGATCACTCCATTTTCCAGA TGG Intergenic
No off target data available for this crispr