ID: 1060731161

View in Genome Browser
Species Human (GRCh38)
Location 9:126037898-126037920
Sequence ATCACTCCATTTTCCAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060731155_1060731161 4 Left 1060731155 9:126037871-126037893 CCCATGCCGTACTCCATCTGTAA No data
Right 1060731161 9:126037898-126037920 ATCACTCCATTTTCCAGATGGGG No data
1060731157_1060731161 -2 Left 1060731157 9:126037877-126037899 CCGTACTCCATCTGTAAAATGAT No data
Right 1060731161 9:126037898-126037920 ATCACTCCATTTTCCAGATGGGG No data
1060731158_1060731161 -9 Left 1060731158 9:126037884-126037906 CCATCTGTAAAATGATCACTCCA No data
Right 1060731161 9:126037898-126037920 ATCACTCCATTTTCCAGATGGGG No data
1060731156_1060731161 3 Left 1060731156 9:126037872-126037894 CCATGCCGTACTCCATCTGTAAA No data
Right 1060731161 9:126037898-126037920 ATCACTCCATTTTCCAGATGGGG No data
1060731154_1060731161 16 Left 1060731154 9:126037859-126037881 CCTTACAATAAGCCCATGCCGTA No data
Right 1060731161 9:126037898-126037920 ATCACTCCATTTTCCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060731161 Original CRISPR ATCACTCCATTTTCCAGATG GGG Intergenic
No off target data available for this crispr