ID: 1060731165

View in Genome Browser
Species Human (GRCh38)
Location 9:126037914-126037936
Sequence GATGGGGAGAGAAGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060731158_1060731165 7 Left 1060731158 9:126037884-126037906 CCATCTGTAAAATGATCACTCCA No data
Right 1060731165 9:126037914-126037936 GATGGGGAGAGAAGTGTGGCAGG No data
1060731156_1060731165 19 Left 1060731156 9:126037872-126037894 CCATGCCGTACTCCATCTGTAAA No data
Right 1060731165 9:126037914-126037936 GATGGGGAGAGAAGTGTGGCAGG No data
1060731155_1060731165 20 Left 1060731155 9:126037871-126037893 CCCATGCCGTACTCCATCTGTAA No data
Right 1060731165 9:126037914-126037936 GATGGGGAGAGAAGTGTGGCAGG No data
1060731157_1060731165 14 Left 1060731157 9:126037877-126037899 CCGTACTCCATCTGTAAAATGAT No data
Right 1060731165 9:126037914-126037936 GATGGGGAGAGAAGTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060731165 Original CRISPR GATGGGGAGAGAAGTGTGGC AGG Intergenic
No off target data available for this crispr