ID: 1060731378

View in Genome Browser
Species Human (GRCh38)
Location 9:126039187-126039209
Sequence GCCACTGTGCGCCAAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060731378_1060731386 -4 Left 1060731378 9:126039187-126039209 CCCAGCCCTTGGCGCACAGTGGC No data
Right 1060731386 9:126039206-126039228 TGGCTCTGAGGGGGCCTGTCTGG No data
1060731378_1060731389 23 Left 1060731378 9:126039187-126039209 CCCAGCCCTTGGCGCACAGTGGC No data
Right 1060731389 9:126039233-126039255 CCTCCCTCCTTACTTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060731378 Original CRISPR GCCACTGTGCGCCAAGGGCT GGG (reversed) Intergenic
No off target data available for this crispr