ID: 1060731386

View in Genome Browser
Species Human (GRCh38)
Location 9:126039206-126039228
Sequence TGGCTCTGAGGGGGCCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060731381_1060731386 -10 Left 1060731381 9:126039193-126039215 CCTTGGCGCACAGTGGCTCTGAG No data
Right 1060731386 9:126039206-126039228 TGGCTCTGAGGGGGCCTGTCTGG No data
1060731379_1060731386 -5 Left 1060731379 9:126039188-126039210 CCAGCCCTTGGCGCACAGTGGCT No data
Right 1060731386 9:126039206-126039228 TGGCTCTGAGGGGGCCTGTCTGG No data
1060731374_1060731386 19 Left 1060731374 9:126039164-126039186 CCGGGAGCCAGTGGCTTGTGGTT No data
Right 1060731386 9:126039206-126039228 TGGCTCTGAGGGGGCCTGTCTGG No data
1060731375_1060731386 12 Left 1060731375 9:126039171-126039193 CCAGTGGCTTGTGGTTCCCAGCC No data
Right 1060731386 9:126039206-126039228 TGGCTCTGAGGGGGCCTGTCTGG No data
1060731380_1060731386 -9 Left 1060731380 9:126039192-126039214 CCCTTGGCGCACAGTGGCTCTGA No data
Right 1060731386 9:126039206-126039228 TGGCTCTGAGGGGGCCTGTCTGG No data
1060731378_1060731386 -4 Left 1060731378 9:126039187-126039209 CCCAGCCCTTGGCGCACAGTGGC No data
Right 1060731386 9:126039206-126039228 TGGCTCTGAGGGGGCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060731386 Original CRISPR TGGCTCTGAGGGGGCCTGTC TGG Intergenic
No off target data available for this crispr