ID: 1060732863

View in Genome Browser
Species Human (GRCh38)
Location 9:126049175-126049197
Sequence CTGGACTTAACGAGGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060732855_1060732863 25 Left 1060732855 9:126049127-126049149 CCACGAGCAATGCTTTATGGGGC No data
Right 1060732863 9:126049175-126049197 CTGGACTTAACGAGGTGAGCAGG No data
1060732857_1060732863 -7 Left 1060732857 9:126049159-126049181 CCGCTGACCCTGCTCCCTGGACT No data
Right 1060732863 9:126049175-126049197 CTGGACTTAACGAGGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060732863 Original CRISPR CTGGACTTAACGAGGTGAGC AGG Intergenic
No off target data available for this crispr