ID: 1060732929

View in Genome Browser
Species Human (GRCh38)
Location 9:126049480-126049502
Sequence GACCCCTGCCTCACAGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060732929_1060732932 -8 Left 1060732929 9:126049480-126049502 CCCCTGTCTGTGAGGCAGGGGTC No data
Right 1060732932 9:126049495-126049517 CAGGGGTCATGATCCACACCTGG No data
1060732929_1060732939 17 Left 1060732929 9:126049480-126049502 CCCCTGTCTGTGAGGCAGGGGTC No data
Right 1060732939 9:126049520-126049542 GGTTGTCCCGAGGTTGGAGAGGG No data
1060732929_1060732933 -4 Left 1060732929 9:126049480-126049502 CCCCTGTCTGTGAGGCAGGGGTC No data
Right 1060732933 9:126049499-126049521 GGTCATGATCCACACCTGGTAGG No data
1060732929_1060732935 7 Left 1060732929 9:126049480-126049502 CCCCTGTCTGTGAGGCAGGGGTC No data
Right 1060732935 9:126049510-126049532 ACACCTGGTAGGTTGTCCCGAGG No data
1060732929_1060732938 16 Left 1060732929 9:126049480-126049502 CCCCTGTCTGTGAGGCAGGGGTC No data
Right 1060732938 9:126049519-126049541 AGGTTGTCCCGAGGTTGGAGAGG No data
1060732929_1060732937 11 Left 1060732929 9:126049480-126049502 CCCCTGTCTGTGAGGCAGGGGTC No data
Right 1060732937 9:126049514-126049536 CTGGTAGGTTGTCCCGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060732929 Original CRISPR GACCCCTGCCTCACAGACAG GGG (reversed) Intergenic