ID: 1060735116

View in Genome Browser
Species Human (GRCh38)
Location 9:126061789-126061811
Sequence CCAGTGGCTGCCACTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060735116_1060735127 26 Left 1060735116 9:126061789-126061811 CCTCTGAGAGTGGCAGCCACTGG No data
Right 1060735127 9:126061838-126061860 AGGATTCCATCAGATCACACAGG No data
1060735116_1060735121 -7 Left 1060735116 9:126061789-126061811 CCTCTGAGAGTGGCAGCCACTGG No data
Right 1060735121 9:126061805-126061827 CCACTGGGGCATCACCCCCAAGG No data
1060735116_1060735122 6 Left 1060735116 9:126061789-126061811 CCTCTGAGAGTGGCAGCCACTGG No data
Right 1060735122 9:126061818-126061840 ACCCCCAAGGACTTATTCTGAGG No data
1060735116_1060735128 27 Left 1060735116 9:126061789-126061811 CCTCTGAGAGTGGCAGCCACTGG No data
Right 1060735128 9:126061839-126061861 GGATTCCATCAGATCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060735116 Original CRISPR CCAGTGGCTGCCACTCTCAG AGG (reversed) Intergenic
No off target data available for this crispr