ID: 1060736205

View in Genome Browser
Species Human (GRCh38)
Location 9:126067960-126067982
Sequence CAGAGCAAGGAGAGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736199_1060736205 -10 Left 1060736199 9:126067947-126067969 CCAGCCAATTAAACAGAGCAAGG No data
Right 1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG No data
1060736198_1060736205 18 Left 1060736198 9:126067919-126067941 CCTTGGCATTCTGTAAAACGGGT No data
Right 1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736205 Original CRISPR CAGAGCAAGGAGAGGGGAGC AGG Intergenic
No off target data available for this crispr